Research Article | Volume: 8, Issue: 3, May-June, 2020

Isolation, identification, and optimization of laccase from Alternaria alternata

Asha T. Thakkar Shreyas A. Bhatt   

Open Access   

Published:  May 26, 2020

DOI: 10.7324/jabb.2020.803012
Abstract

Laccase, lignin peroxidase, and manganese peroxidase have a synergistic effect on a wide range of recalcitrant compounds. Among them, laccase is polyphenol oxidase widely available in fungi, plant species, and insects. Laccase has an important role in effluent decoloration, detoxification of pulp bleaching, and bioremediation process. Screening was carried out to find new fungal isolate for the presence of laccase activity with guaiacol as indicator compound. Sixteen fungal isolates were obtained from biodeteriorated agro waste and the wood samples were collected from North Gujarat region of India. Among these isolates, one of the fungal isolates was observed with good laccase activity and identified as Alternaria alternata. Laccase activity was determined using 2,2’-azinobis-(3-ethylbenzethiazoline-6-sulfonate) as substrate. Various production parameters such as pH, temperature, various carbon sources, nitrogen source, inducers, and cations were used to select the optimum condition for further increase in the production of this enzyme. Maximum laccase activity was obtained with glucose and sucrose as carbon source, 0.2% ammonium sulfate as nitrogen source, and 0.06% Cu+2 with 1.5 mM veratryl alcohol as inducer under optimized condition.


Keyword:     Lignocellulose guaiacol laccase fungi optimization.


Citation:

Thakkar AT, Bhatt SA. Isolation, identification and optimization of laccase from Alternaria alternata. J Appl Biol Biotech, 2020;8(03):064-069. DOI: dx.doi.org/10.7324/JABB.2020.803012

Copyright: Author(s). This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike license.

HTML Full Text

1. INTRODUCTION

The lifestyle of human can be improved by new innovations, research, and scientific achievements but ruins the environment differently. Different types of toxic chemicals which present in the environment are one of the major reasons for water toxicity which leads to adverse reaction on livelihood as well as on nature. Microbes have a massive capacity to reduce the toxicity of several types of chemicals with the help of enzymes. Laccase has diverse substrate flexibility which makes it highly interesting for diverse application, such as industrial development, pulp and textile dye bleaching, and bioremediation and detoxification of industrial effluents, and avoids environmental deteriorations [13]. Laccase has the most important impact on the reduction of diverse variety of pollutants, which is the thrust area to reduce environment pollution [2].

Laccases (benzenediol: dioxygen oxidoreductases, EC 1.10.3.2) are enzymes belonging to the class of blue oxidase-containing copper at catalytic site, composed of glycoproteins that oxidize a wide variety of phenolic compounds and aromatic amines and release free hydroxyl radicals for degradation of complexed compounds [25].

Lignin is the most recalcitrant components in lignocellulosic biomass that entraps the cellulose and hemicellulose. Pretreatment of lignocellulosic biomass is required to release fermentable sugar which can be accomplished by laccase [6]. Laccase plays a vital role in plant pathogenesis, pigment production, and lignocellulose degradation from agro waste [2]. The laccases from wood-rotting basidiomycetes are of significant interest as they have a potential to utilize different types of compounds such as aromatic compounds, phenols, and building blocks of lignin as carbon sources. Laccase also has a capacity to degrade lignin-mimicking compounds such as reactive, polymeric, and heterocyclic dyes [6].

Chemical pretreatment processes to release the fermentable sugars are expensive, difficult to operate, and environmentally unfriendly, and side-products after lignin breakdown during chemical delignification can lead to inhibitory effects on fermentation process. Depolymerization of lignin with the aid of laccases is a biological method which is far safer and economic alternatives to obtain fermentable sugars from lignocellulosic biomass [6].

The objective of the present study was to isolate and characterize laccase-producing fungi from agro waste and decayed wood material with the help of indicators to identify new laccase-producing fungal sources. Few studies were available for laccase in brown-rot fungi excluding reports on LiPs and MnPs activities [7]. Accordingly, as a part of this study, we have screened brown-rot fungal species to identify potent laccase producer and optimized enzyme production conditions for Ascomycetes species Alternaria alternata NS-6.


2. MATERIALS AND METHODS

2.1. Materials

Guaiacol and potato dextrose agar (PDA) were obtained from HiMedia. 2,2’-azinobis-(3-ethylbenzethiazoline-6-sulfonate) (ABTS), syringaldazine, and veratryl alcohol (3,4 dimethoxybenzyl alcohol) were acquired from Sigma-Aldrich (Germany). Analytical grade chemicals and reagents were used for the study.

2.2. Screening and Isolation of Fungi

A total of 5 decomposed wood samples and 25 agro waste samples were collected in sterile plastic bags from different areas of North Gujarat. To isolate lignolytic fungi, the samples were inoculated in potato dextrose broth with the use of lignin (5% w/v) as major carbon source along with glucose (1% w/v) for 5–7 days for the primary screening. The secondary screening was performed with the use of guaiacol (0.02% v/v) in PDA plate [1,3,8]. This plate assay helps to screen laccase-producing fungi by brown halos formation around colony. The medium was inoculated with fungal species and incubated for 7–10 days for the growth of fungi. A positive culture was subcultured when it shows positive result. One of the species, NS-6 isolate, which recorded with high production of brown color around colony, was selected for identification. Sequencing of the fungal isolate was carried out by Chromous Biotech (Bengaluru, India) using primers Internal Transcribed Spacer (ITS) 1 (5´ TCCGTRSGNGAACYTGHGG 3´) and ITS 4 (5´ TCCTCCGCTTATTKATDTGC 3´) [9,10] on an Applied Biosystem (ABI) 3500 XL Analyzer (USA), and the alignment of sequence was carried out using the Molecular Evolutionary Genetic Analysis version 6 (MEGA6) system software [11].

2.3. Extracellular Laccase Activity

Laccase activity was analyzed spectrophotometrically with a mixture containing 50 mM ABTS in 100 mM Na-Acetate buffer (pH 5.0) with absorption maxima of 420 nm and an extinction coefficient of 36,000 M−1 cm−1 [1214]. The nonphenolic dye ABTS is converted to more stable state of cations which are responsible for intense green color [15,16]. Intense green color was observed due to more stable state of ABTS which was formed during reaction. Here, the laccase activity was determined with the use of suitable control and expressed as U/ml. About 1 μmol of ABTS substrate oxidized per minutes is considered as one unit activity of laccase. The Bradford method was used to check the protein content of the sample [17].

2.4. Cultivation of Fungal Isolate

The quantitative determination of laccase activity was done by cultivation of fungal species in modified Kirk’s medium, composed of (g/l): MgSO4.7H2O (0.05), CaCl2 (0.01), KH2PO4 (0.20), glucose (10), thiamine (0.1), 2.2-dimethylsuccinic acid (2.90), ammonium tartrate (0.22), veratryl alcohol (1.5 mM), and tween 80 (0.10% v/v). Trace metal salt elements were also used with concentration (mg/l): Fe2(SO4)3 (50), CuSO4.7H2O (80), H2MoO4 (50), MnSO4 (33), and ZnSO4.7H2O (43) [18,19]. Six agar plugs (cylindrical) were added from edge of mycelium growth in malt extract plate, and incubation was done at 30°C for 9 days. The samples were centrifuged at 9,500 xg for 10 minutes at 4°C temperature, and the crude laccase activity was analyzed from supernatants [20,21].

2.5. Optimization of Process Parameters

The impact of various nitrogen and carbon compounds, such as nutrient sources, factors viz., pH and temperature, cations and inducers which were checked for optimum condition on laccase production by the fungus, was studied in a growth medium [17]. The laccase from the isolate NS-6 was investigated for its pH optima over a pH range of 2.5–6.5. The fungal isolate was incubated under optimum pH with the range of temperature from 25°C to 50°C for laccase production [15]. Nutrient source in form of carbon and nitrogen compounds was utilized for optimum growth of fungal isolates. Carbon sources such as glucose, maltose, mannitol, sucrose and lactose were used (10% w/v). Inorganic nitrogen sources, such as sodium nitrate and ammonium nitrate ammonium sulfate, and organic sources, such as peptone and yeast extracts were used at a final concentration of 0.2%.

Different cations were used to find the most suitable cations for laccase production [15,22]. To check alternative source for veratryl alcohol, various other organic inducers such as syringaldazine, thiamine HCl, 2,6-dimethoxyphenol (DMP), and lignin were incorporated in Kirk’s medium. All inducers were filter-sterilized except lignin and added into the medium.

Figure 1: A. alternata with brown halos formation in guaiacol-containing plate.

[Click here to view]


3. RESULTS AND DISCUSSION

Extracellular laccase activity was observed in 16 isolated fungal species. Brown colored halos around fungal mycelium in guaiacol containing PDA medium were examined for the presence of laccase production potential by isolates (Fig. 1). NS-6 designated isolate was found to be the best among the 16 isolates with good brown halos formation. Thus, this screening helps us to select the most promising fungal isolate. One of the observations showed reduced mycelium growth when incubated with guaiacol containing solid medium, which may be due to the changes in some metabolic activity of isolates during growth in selected media [23].

The identification of NS-6 was further confirmed with the studies on its 18S rRNA sequencing, carried out by Chromous Biotech, India. The isolate was identified as A. alternata NS-6 (Table 1). The sequence was submitted in the GenBank database (accession no. MF348243). Observation of Basic Local Alignment Search Tool (BLAST) analysis of the amplificons indicates the highest similarities with over 99% sequences generated from Alternaria strains. The phylogenetic tree was prepared by the neighbor-joining (N-J) method using MEGA6 software (Fig. 2). Here, 5.8S rDNA sequence was used to construct phylogenetic tree for A. alternata. The result revealed that NS-6 strain was closely related to Alternaria brassicae and Alternaria brassicicola (Fig. 2).

There is a general increase in temperature observed due to the respiration of organisms. It is observed as an important factor during enzyme production and fungal growth and has a major impact during scale-up process at industrial level [24]. A. alternata has good laccase activity at the temperature of 30°C (Fig. 3). Many research articles also noticed high laccase activity for A. alternata with 35°C incubation temperature [25]. The pH is one of the crucial parameters for fungal cultivation. The optimum pH for the laccase oxidation of ABTS was 4.5 with reduction of activity at high pH. It may have an optimal pH range of 3.5–5.5 (Fig. 4). This may be due to the modification of catalytic site of enzyme with variation in pH [24]. A. alternata has also shown a high laccase activity at pH 5 [25].

Different types of carbon and nitrogen sources in suitable amount on fungal adaptation are important for the production of laccase. Lignolytic enzyme production is also influenced by nature and concentration of nitrogen source as powerful nutritional factor by wood-rotting fungi [24]. Lignolytic enzyme production has a vital role in the growth of fungus and helps to degrade lignin present in solid lignocellulosic substrate [26]. Different sugar sources show different laccase activities. Present study showed that glucose (1%) has an influence on laccase activity which may have an effect on growth also (Fig. 5). It also showed good laccase activity with sucrose (1%) which may increase the chances of the use of waste industrial molasses for industrial laccase production. A variety of nitrogen sources helps to induce laccase activity with the use of its significant amount. A. alternata with 2.4-mM ammonium sulfate has a considerable effect on laccase activity. Ammonium nitrate also has a remarkable impact on laccase activity (Fig. 6). Decolorization of effluent was also affected by a variety of nitrogen sources by researchers [27].

Table 1: Identification of fungal isolate.

OrganismAccession No.Sequence
A. alternataMF348243TGAGGTAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACT
AGGACAAACATATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGC
ATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTT
GGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGAC
TCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAG
CCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA

Figure 2: Phylogenetic relationship of A. alternata.

[Click here to view]

Figure 3: Effect of temperature on laccase activity.

[Click here to view]

Figure 4: Effect of pH on laccase activity.

[Click here to view]

Figure 5: Effect of carbon source on laccase activity.

[Click here to view]
Figure 6: Effect of nitrogen sources on laccase activity.

[Click here to view]

Figure 7: Effect of inducers on laccase activity.

[Click here to view]

Aromatic compounds help to induce the production of laccase. Veratryl alcohol had an inductive effect during optimization process with 273.32 U/ml laccase activity. DMP also showed a positive effect on laccase production (Fig. 7). Arora and Gill (2001) have studied the influence of veratryl alcohol on laccase production in Ganoderma lucidum, Trametes versicolor, and Dichomitus squalens [28]. The highest laccase activity was 72.13 U/ml, observed with Cu+2 after 9 days of incubation (Fig. 8). Regulation of laccase expression can be observed with the use of selected metal ions. Affinity for different metal ions was recorded for different species. Laccase activity in almost all fungi can be influenced by copper in T. versicolor, Ceriporiopsis subvermispora, Pleurotus ostreatus, and Trametes pubescens. At the transcription level, copper-mediated regulation was observed [29]. Fe+2 is also reported as an important cation to induce laccase activity in Pleurotus eryngii [30] and Trametes velutina [31].

Figure 8: Effect of cations on laccase activity.

[Click here to view]


4. CONCLUSION

The present study illustrates that A. alternata NS-6 has the ability to produce brown halos on guaiacol (0.02%) containing media. Various production parameters such as pH, temperature, carbon, nitrogen source, cation, and organic inducers have a potential effect on laccase production. The final laccase activity obtained 273.32 U/ml, with a supplementation of 1.5 mM veratryl alcohol.


CONFLICT OF INTEREST

The authors declare that they do not have any conflicts of interest.


FINANCIAL SUPPORT

None.


REFERENCES

1. Amutha C, Abhijit M. Screening and isolation of laccase producers, determination of optimal condition for growth, laccase production and choose the best strain. J Bioremed Biodegredation 2015; 6(4):1–8; doi:10.4172/2155-6199.1000298

2. More SS, Renuka PS, Malini S. Isolation, purification, and characterization of fungal laccase from Pleurotus sp. Enzyme Res 2011; 2011:1–7. doi:10.4061/2011/248735

3. Viswanath B, Chandra MS, Pallavi H, Reddy BR. Screening and assessment of laccase producing fungi isolated from different environmental samples. Afr J Biotechnol 2008; 7(8):1–21.

4. Brijwani K, Rigdon A, Vadlani PV. Fungal laccases: production, function, and applications in food processing. Enzyme Res 2010; 2010:1–10; doi:10.4061/2010/149748

5. Alfarra HY, Hasali NHM, Omar MN. A lignolytic fungi with laccase activity isolated from Malaysian local environment for phytochemical transformation purposes. Int Res J Biol Sci 2013; 2(2):51–4.

6. Shrestha P, Joshi B, Joshi J, Malla R, Sreerama L. Isolation and physicochemical characterization of laccase from Ganoderma lucidum-CDBT1 isolated from its native habitat in Nepal. BioMed Res Int 2016; 2016:1–10; doi:10.1155/2016/3238909

7. D'Souza TM, Boominathan K, Reddy CA. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR. Appl Environ Microbiol 1996; 62(10):3739–44; doi:0099-2240/96/$04.0010

8. Vantamuri AB, Adhoni SA, Nadaf PD, Payamalle S, Guruvin SK, Manawadi SI. Isolation and characterization of laccase producing fungi from different environmental samples. Int J Recent Sci Res 2015; 6:6853–7.

9. White TJ, Bruns T, Lee SJWT, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocol: Guide Methods Appl 1990; 18(1):315–22. CrossRef

10. Gardes M, Bruns TD. ITS primers with enhanced specificity for basidiomycetes-application to the identification of mycorrhizae and rusts. Mol Ecol 1993; 2(2):113–8. CrossRef

11. Bruno WJ, Socci ND, Halpern, AL. Weighted neighbor joining: a likelihood-based approach to distance-based phylogeny reconstruction. Mol Biol Evol 2000; 17(1):189–97. CrossRef

12. Paice MG, Reid ID, Bourbonnais R, Archibald FS, Jurasek L. Manganese peroxidase, produced by Trametes versicolor during pulp bleaching, demethylates and delignifies kraft pulp. Appl Environ Microbiol 1993; 59(1):260–5; doi:0099-2240/93/010260-06$02.00/0

13. Thakur S, Shrivastava B, Ingale S, Kuhad RC, Gupte A. Degradation and selective ligninolysis of wheat straw and banana stem for an efficient bioethanol production using fungal and chemical pretreatment. 3 Biotech 2013; 3(5):365–72; doi:10.1007/s13205-012-0102-4

14. Vares T, Kalsi M, Hatakka A. Lignin peroxidases, manganese peroxidases, and other ligninolytic enzymes produced by Phlebiaradiata during solid-state fermentation of wheat straw. Appl Environ Microbiol 1995; 61(10):3515–20; doi:0099-2240/95/$04.0010 CrossRef

15. Kandasamy S, Muniraj IK, Purushothaman N, Sekar A, Sharmila DJS, Kumarasamy R, Uthandi S. High level secretion of laccase (LccH) from a newly isolated white-rot basidiomycete, Hexagoniahirta MSF2. Front Microbiol 2016; 7:1–11; doi:10.3389/fmicb.2016.00707 CrossRef

16. Risdianto H, Sofianti E, Suhardi SH, Setiadi T. Optimization of laccase production using white rot fungi and agricultural wastes in solid-state fermentation. J Eng Technol Sci 2012; 44(2):93–105; doi:10.5614/itbj.eng.sci.2012.44.2.1 CrossRef

17. Jaber SM, Shah UKM, Asa’ari AZM, Ariff AB. Optimization of laccase production by locally isolated Trichoderma muroiana IS1037 using rubber wood dust as substrate. BioResources. 2017; 12(2):3834–49. CrossRef

18. Atalla M, Zeinab H, Eman R, Amani A, Abeer A. Screening of some marine-derived fungal isolates for lignin degrading enzymes (LDEs) production. Agricul Biol J North Am 2010; 1(4):591–9.

19. Järvinen J, Taskila S, Isomäki R, Ojamo H. Screening of white-rot fungi manganese peroxidases: a comparison between the specific activities of the enzyme from different native producers. AMB Express 2012; 2(62):1–9; doi:10.1186/2191-0855-2-62

20. Kalmis E, Yasa I, Kalyoncu F, Pazarbasi B, Koçyigit A. Ligninolytic enzyme activities in mycelium of some wild and commercial mushrooms. Afr J Biotechnol 2008; 7(23):4314–20.

21. El-Aty AAA, Mostafa FA. Effect of various media and supplements on laccase activity and its application in dyes decolorization. Malaysian J Microbiol 2013; 9(2):166–75; doi:10.21161/mjm.47712

22. Desai SA. Isolation and characterization of Laccase producing bacteria from contaminated sites. Biosci Discov 2017; 8:567–73.

23. Kaur H, Kapoor S, Sharma S. An efficient method for qualitative screening of ligninolytic enzyme potential of Ganoderma lucidum. Int J Curr Microbiol Appl Sci 2018; 7(8):2442–59; doi:10.20546/ijcmas.2018.708.247

24. Patel H, Gupte A, Gupte S. Effect of different culture conditions and inducers on production of laccase by a basidiomycete fungal isolate Pleurotus ostreatus HP-1 under solid state fermentation. BioResources 2009; 4(1):268–84.

25. Irfan M, Mehmood S, Irshad M, Anwar Z. Optimized production, purification and molecular characterization of fungal laccase through Alternaria alternata. Turkish J Biochem 2018; 43(6):613–22; doi:10.1515/tjb-2017-0239

26. Onyancha W. Degradation of agroresiduces with value added products by solid state fermentation with calocybe indicay. J Biol, Agricul Healthcare 2016; 6(20):27–41.

27. D’Souza-Ticlo D, Verma AK, Mathew M, Raghukumar C. Effect of nutrient nitrogen on laccase production, its isozyme pattern and effluent decolorization by the fungus NIOCC# 2a, isolated from mangrove wood. Indian J Marine Sci 2006; 35(4):364–72.

28. Arora DS, Gill PK. Effects of various media and supplements on laccase production by some white rot fungi. Bioresour Technol 2001; 77(1):89–91; doi:10.1016/S0960-8524(00)00114-0

29. Zhu C, Bao G, Huang S. Optimization of laccase production in the white-rot fungus Pleurotus ostreatus (ACCC 52857) induced through yeast extract and copper. Biotechnol Biotechnological Equip 2016; 30(2):270–6; doi:10.1080/13102818.2015.1135081

30. Staji? M, Vukojevi? J. Interaction of trace elements and ligninolytic enzymes in Pleurotus eryngii. Biol Trace Elem Res 2011; 143(2):1202–8; doi:10.1007/s12011-010-8918-4

31. Yang Y, Wei F, Zhuo R, Fan F, Liu H, Zhang C, et al. Enhancing the laccase production and laccase gene expression in the white-rot fungus Trametes velutina 5930 with great potential for biotechnological applications by different metal ions and aromatic compounds. PLoS One 2013; 8(11):e79307; doi:10.1371/journal.pone.0079307

Reference

1. Amutha C, Abhijit M. Screening and isolation of laccase producers, determination of optimal condition for growth, laccase production and choose the best strain. J Bioremed Biodegredation 2015; 6(4):1-8; doi:10.4172/2155- 6199.1000298

2. More SS, Renuka PS, Malini S. Isolation, purification, and characterization of fungal laccase from Pleurotus sp. Enzyme Res 2011; 2011:1-7. doi:10.4061/2011/248735

3. Viswanath B, Chandra MS, Pallavi H, Reddy BR. Screening and assessment of laccase producing fungi isolated from different environmental samples. Afr J Biotechnol 2008; 7(8):1-21.

4. Brijwani K, Rigdon A, Vadlani PV. Fungal laccases: production, function, and applications in food processing. Enzyme Res 2010; 2010:1-10; doi:10.4061/2010/149748

5. Alfarra HY, Hasali NHM, Omar MN. A lignolytic fungi with laccase activity isolated from Malaysian local environment for phytochemical transformation purposes. Int Res J Biol Sci 2013; 2(2):51-4.

6. Shrestha P, Joshi B, Joshi J, Malla R, Sreerama L. Isolation and physicochemical characterization of laccase from Ganoderma lucidum-CDBT1 isolated from its native habitat in Nepal. BioMed Res Int 2016; 2016:1-10; doi:10.1155/2016/3238909

7. D'Souza TM, Boominathan K, Reddy CA. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR. Appl Environ Microbiol 1996; 62(10):3739-44; doi:0099- 2240/96/$04.0010

8. Vantamuri AB, Adhoni SA, Nadaf PD, Payamalle S, Guruvin SK, Manawadi SI. Isolation and characterization of laccase producing fungi from different environmental samples. Int J Recent Sci Res 2015; 6:6853-7.

9. White TJ, Bruns T, Lee SJWT, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocol: Guide Methods Appl 1990; 18(1):315-22.https://doi.org/10.1016/B978-0-12-372180-8.50042-1

10. Gardes M, Bruns TD. ITS primers with enhanced specificity for basidiomycetes-application to the identification of mycorrhizae and rusts. Mol Ecol 1993; 2(2):113-8.https://doi.org/10.1111/j.1365-294X.1993.tb00005.x

11. Bruno WJ, Socci ND, Halpern, AL. Weighted neighbor joining: a likelihood-based approach to distance-based phylogeny reconstruction. Mol Biol Evol 2000; 17(1):189-97.https://doi.org/10.1093/oxfordjournals.molbev.a026231

12. Paice MG, Reid ID, Bourbonnais R, Archibald FS, Jurasek L. Manganese peroxidase, produced by Trametes versicolor during pulp bleaching, demethylates and delignifies kraft pulp. Appl Environ Microbiol 1993; 59(1):260-5; doi:0099-2240/93/010260-06$02.00/0

13. Thakur S, Shrivastava B, Ingale S, Kuhad RC, Gupte A. Degradation and selective ligninolysis of wheat straw and banana stem for an efficient bioethanol production using fungal and chemical pretreatment. 3 Biotech 2013; 3(5):365-72; doi:10.1007/s13205-012- 0102-4

14. Vares T, Kalsi M, Hatakka A. Lignin peroxidases, manganese peroxidases, and other ligninolytic enzymes produced by Phlebiaradiata during solid-state fermentation of wheat straw. Appl Environ Microbiol 1995; 61(10):3515-20; doi:0099-2240/95/$04.0010https://doi.org/10.1128/AEM.61.10.3515-3520.1995

15. Kandasamy S, Muniraj IK, Purushothaman N, Sekar A, Sharmila DJS, Kumarasamy R, Uthandi S. High level secretion of laccase (LccH) from a newly isolated white-rot basidiomycete, Hexagoniahirta MSF2. Front Microbiol 2016; 7:1-11; doi:10.3389/fmicb.2016.00707https://doi.org/10.3389/fmicb.2016.00707

16. Risdianto H, Sofianti E, Suhardi SH, Setiadi T. Optimization of laccase production using white rot fungi and agricultural wastes in solid-state fermentation. J Eng Technol Sci 2012; 44(2):93-105; doi:10.5614/itbj. eng.sci.2012.44.2.1https://doi.org/10.5614/itbj.eng.sci.2012.44.2.1

17. Jaber SM, Shah UKM, Asa'ari AZM, Ariff AB. Optimization of laccase production by locally isolated Trichoderma muroiana IS1037 using rubber wood dust as substrate. BioResources. 2017; 12(2):3834-49.https://doi.org/10.15376/biores.12.2.3834-3849

18. Atalla M, Zeinab H, Eman R, Amani A, Abeer A. Screening of some marine-derived fungal isolates for lignin degrading enzymes (LDEs) production. Agricul Biol J North Am 2010; 1(4):591-9.

19. Järvinen J, Taskila S, Isomäki R, Ojamo H. Screening of white-rot fungi manganese peroxidases: a comparison between the specific activities of the enzyme from different native producers. AMB Express 2012; 2(62):1-9; doi:10.1186/2191-0855-2-62

20. 20. Kalmis E, Yasa I, Kalyoncu F, Pazarbasi B, Koçyigit A. Ligninolytic enzyme activities in mycelium of some wild and commercial mushrooms. Afr J Biotechnol 2008; 7(23):4314-20.

21. El-Aty AAA, Mostafa FA. Effect of various media and supplements on laccase activity and its application in dyes decolorization. Malaysian J Microbiol 2013; 9(2):166-75; doi:10.21161/mjm.47712

22. Desai SA. Isolation and characterization of Laccase producing bacteria from contaminated sites. Biosci Discov 2017; 8:567-73.

23. Kaur H, Kapoor S, Sharma S. An efficient method for qualitative screening of ligninolytic enzyme potential of Ganoderma lucidum. Int J Curr Microbiol Appl Sci 2018; 7(8):2442-59; doi:10.20546/ ijcmas.2018.708.247

24. Patel H, Gupte A, Gupte S. Effect of different culture conditions and inducers on production of laccase by a basidiomycete fungal isolate Pleurotus ostreatus HP-1 under solid state fermentation. BioResources 2009; 4(1):268-84.

25. Irfan M, Mehmood S, Irshad M, Anwar Z. Optimized production, purification and molecular characterization of fungal laccase through Alternaria alternata. Turkish J Biochem 2018; 43(6):613-22; doi:10.1515/tjb-2017-0239

26. Onyancha W. Degradation of agroresiduces with value added products by solid state fermentation with calocybe indicay. J Biol, Agricul Healthcare 2016; 6(20):27-41.

27. D'Souza-Ticlo D, Verma AK, Mathew M, Raghukumar C. Effect of nutrient nitrogen on laccase production, its isozyme pattern and effluent decolorization by the fungus NIOCC# 2a, isolated from mangrove wood. Indian J Marine Sci 2006; 35(4):364-72.

28. Arora DS, Gill PK. Effects of various media and supplements on laccase production by some white rot fungi. Bioresour Technol 2001; 77(1):89-91; doi:10.1016/S0960-8524(00)00114-0

29. Zhu C, Bao G, Huang S. Optimization of laccase production in the white-rot fungus Pleurotus ostreatus (ACCC 52857) induced through yeast extract and copper. Biotechnol Biotechnological Equip 2016; 30(2):270-6; doi:10.1080/13102818.2015.1135081

30. Staji? M, Vukojevi? J. Interaction of trace elements and ligninolytic enzymes in Pleurotus eryngii. Biol Trace Elem Res 2011; 143(2):1202- 8; doi:10.1007/s12011-010-8918-4

31. Yang Y, Wei F, Zhuo R, Fan F, Liu H, Zhang C, et al. Enhancing the laccase production and laccase gene expression in the white-rot fungus Trametes velutina 5930 with great potential for biotechnological applications by different metal ions and aromatic compounds. PLoS One 2013; 8(11):e79307; doi:10.1371/journal.pone.0079307

Article Metrics
558 Views 249 Downloads 807 Total

Year

Month

Related Search

By author names

Similar Articles

Polyphenol oxidase (PPO) based biosensors for detection of phenolic compounds: A Review

Ijaz Gul, M. Sheeraz Ahmad, S. M. Saqlan Naqvi, Ansar Hussain, Rahmat Wali, Ammad Ahmad Farooqi, Ibrar Ahmed

Laccase production by Myrothecium gramineum and its optimization under solid state fermentation using cowpea pod as substrate

V. Daphne Vivienne Gnanasalomi, J. Joel Gnanadoss

Molecular characterization of the ligninolytic Sundarban mangrove isolate Stenotrophomonas maltophilia GD1 and its promising applications in the dye and fiber industry

Somnath Das, Mitun Sen, Nilothpal Sinha, Suryasarathi Kumar, Noiranjana Dasgupta, Dipankar Ghosh

Decolorization of selected industrial synthetic dyes using laccase from an indigenous isolate strain SK1

Maegala Nallapan Maniyam,, Primeela Gunalan,, Hazeeq Hazman Azman, Hasdianty Abdullah,, Nor Suhaila Yaacob,

Bioactivity assessment of endophytic fungi associated with Centella asiatica and Murraya koengii

Archana Nath, Jyoti Pathak and SR Joshi

Enzymes and qualitative phytochemical screening of endophytic fungi isolated from Lantana camara Linn. Leaves

Mbouobda Hermann Desire , Fotso Bernard , Muyang Rosaline Forsah , Chiatoh Thaddeus Assang, Omokolo Ndoumou Denis

Biodiversity of arbuscular mycorrhizal fungi of pumpkins (Cucurbita spp.) under the influence of fertilizers in ferralitic soils of Cameroon and Benin

Judith Taboula Mbogne , Carine Nono Temegne , Pascal Hougnandan, Emmanuel Youmbi , Libert Brice Tonfack , Godswill Ntsomboh-Ntsefong

Production and Characterization of Collagenase by Penicillium sp. UCP 1286 Isolated From Caatinga Soil

Maria Carolina de Albuquerque Wanderley , Jose Manoel Wanderley Duarte Neto, Carolina de Albuquerque Lima, Sara Isabel da Cruz Silverio, Jose Luiz de Lima Filho, Jose Antonio Couto Teixeira, Ana Lucia Figueiredo Porto

Screening, Selection and Optimization of the Culture Conditions for Tannase Production by Endophytic Fungi Isolated from Caatinga

Rayza Morganna Farias Cavalcanti, Pedro Henrique de Oliveira Ornela, João Atílio Jorge, Luís Henrique Souza Guimarães

Studies on the Optimization of Lipase Production by Rhizopus sp. ZAC3 Isolated from the Contaminated Soil of a Palm Oil Processing Shed

Zainab Adenike Ayinla, Adedeji Nelson Ademakinwa, Femi Kayode Agboola

In vitro antagonistic activity of a root endophytic fungus towards plant pathogenic fungi

K. Talapatra, A. Roy Das, A. K. Saha, P. Das

Biocatalysis of agro-processing waste by marine Streptomyces fungicidicus strain RPBS-A4 for cellulase production

Rajanikanth Akurathi, Damodharam Thoti

Purification and characterization of tannase from the local isolate of Aspergillus niger

Saja Taha Yaseen Al-Mraai, Dhia Falih Al-Fekaiki, Alaa Jabbar Abd Al-Manhel

A study of endophytic fungi Neofusicoccum ribis from Gandaria (Bouea macrophylla Griffith) as enzyme inhibitor, antibacterial, and antioxidant

Trisanti Anindyawati, Praptiwi

Root-fungal associations in plants from home gardens of Tripura, Northeast India

Kripamoy Chakraborty, Atithi Debnath, Aparajita Roy Das, Ajay Krishna Saha, Panna Das

Impact of chemical properties of soil on spore density, colonization, and distribution of native arbuscular mycorrhizal fungi associated with Capsicum annuum L.

Komal Chandrakant Dhumal, Bharat Pandharinath Shinde

Distribution and species listing of wild macrofungi in Sitio Canding, Barangay Maasin, San Clemente, Tarlac Province, Philippines

Rich Milton Dulay, Jose Santos Carandang VI, Sofronio Kalaw, Renato Reyes

Distribution and diversity of endophytic fungi associated with three medicinal tree species from Eturnagaram Wildlife Sanctuary, TS, India

Bhavani Vemireddy, Abhinesh Madasi, Aruna Ajmeera, Krishna Reddy Vanteru

An effective and eco-friendly technique for control of post-harvest fungal pathogens of orange (Citrus sinensis) isolated from the distribution chain of Delhi NCR

Gayatri Krishna, Geethu Gopinath, Anupama Sharma Avasthi

Statistical optimization of fermentation media for beta lactamase inhibitor kalafungin production from marine Streptomyces sp. SBRK1

Thankaraj Rajam Jabila Mary, Rajaretinam Rajesh Kannan, Appadurai Muthamil Iniyan, Samuel Gnana Prakash Vincent

Diversity and antimicrobial potential of endophytic fungi from aromatic plants of Bhadra Wildlife Sanctuary, Western Ghats, Karnataka

Rajeshwari Jagadish, Srinivas Chowdappa

Rice crop loss due to major pathogens and the potential of endophytic microbes for their control and management

Shubhransu Nayak, Soma Samanta, Chandan Sengupta, Soumya Sephalika Swain

Molecular identification of endophytic fungi associated with Coleus forskohlii (Willd.) Briq.

Grace Leena Crasta,, Koteshwar Anandrao Raveesha,

Arbuscular mycorrhizal fungi as a potential biofertilizers for agricultural sustainability

Kumar Anand, Gaurav Kumar Pandey, Tanvir Kaur, Olivia Pericak, Collin Olson, Rajinikanth Mohan, Kriti Akansha, Ashok Yadav, Rubee Devi, Divjot Kour, Ashutosh Kumar Rai, Manish Kumar, Ajar Nath Yadav

Seasonal effect on the diversity of soil fungi and screening for arsenic tolerance and their remediation

Dheeraj Pandey, Harbans Kaur Kehri, Ifra Zoomi, Shweta Chaturvedi, Kanhaiya Lal Chaudhary

Antimicrobial, anticancer, and antioxidant potential of two dominant macro-lichen Dirinaria aegialita and Parmotrema praesorediosum collected from Similipal Biosphere Reserve of Odisha, India

Srimay Pradhan, Dalip Kumar Upreti, Rajesh Kumar Meher, Kunja Bihari Satapathy

Implications of abiotic stress tolerance in arbuscular mycorrhiza colonized plants: Importance in plant growth and regulation

Madhulika Singh,, Sanskriti Bisht, Shatrupa Singh, Jai Gopal Sharma

Microbes as a potential bioremediation tool for atrazine-contaminated soil: A review

Chiranjib Mili, Sanjib Kalita, Subham Roy

Endophytic Fungi as Emerging Bioresources for Bioactive Compounds for Sustainable Development

Divjot Kour, Neelam Yadav, Ajar Nath Yadav

Microbe-mediated remediation of dyes: Current status and future challenges

Kriti Akansha, Tanvir Kaur, Ashok Yadav, Divjot Kour, Ashutosh Kumar Rai, Sangram Singh, Shashank Mishra, Lalit Kumar, Kanika Miglani, Karan Singh, Ajar Nath Yadav

A review on the biological properties of Trichoderma spp. as a prospective biocontrol agent and biofertilizer

Abdul Muizz Al-Azim Abdul-Halim, Pooja Shivanand, Sarayu Krishnamoorthy, Hussein Taha

Isolation of yeast endophytes from healthy seeds of Capsicum annuum L. and assessment of their antimicrobial activity

Barbi Bhuyan, Purthimi Kungri Hansepi, Suraiya Akhtar, Raja Ahmed, Rafiul Amin Laskar, Kumanand Tayung

Beneficial fungal communities for sustainable development: Present scenario and future challenges

Divjot Kour, Sofia Sharief Khan, Seema Ramniwas, Sanjeev Kumar, Ashutosh Kumar Rai, Sarvesh Rustagi, Kundan Kumar Chaubey, Sangram Singh, Ajar Nath Yadav,, Amrik Singh Ahluwalia

Activity of antioxidants on various crops by the inoculation of Mycorrhiza under drought stress: A review

Shailja Sharma, Suhail Fayaz, Rajesh Kumar, Navjot Rana, Rajeev Kashyap, Sourabh Kumar, Dipti Bisarya, Tauseef A . Bhat, Aijaz Nazir

The arbuscular mycorrhizal fungi inoculation affects plant growth and flavonoid content in tomato plant (Lycopersicum esculentum Mill.)

Rusdi Hasan, Tia Setiawati, Dede Sukirman, Mohamad Nurzaman

Study of morphology and orchid mycorrhizal associations in Malaxis rheedei

B. S. Jyothsna, Radha Mahendran, Manish Raj Mishra, Sanjay Dey, Deepti Srivastava

Agronomic and disease responses of three watermelon (citrilus lanatus l.) varieties to fungicide spraying regimes in a tropical environment

Nathaniel Dauda , Sandra Nneamaka Ugwuagu, Patience Ukamaka Ishieze, Kevin Ugwuoke, Vivian Ogechi Osadebe, Solomon Oluwaseyi Adewuyi, Uchenna Noble Ukwu

Genome mining and AntiSMASH analysis of an Endophytic Talaromyces sp. reveal biosynthetic pathway gene clusters for novel bioactive compounds

Priyanka N. Shenoy, Sneha Bhaskar, M. Manu, M. P. Likitha, N. Geetha, Shailasree Sekhar, K Ramachandra Kini

Impact of Jeevamrut formulations and biofertilizers on soil microbial and chemical attributes during potato cultivation

Rudra Pratap Singh Gurjar, Dashrath Bhati, Shailesh Kumar Singh

In vitro anti-cancer potency of Mortierella elongata lipids against MCF 7 cells through induction of apoptosis and cell cycle arrest

S. Ida Poornima, V. Judia Harriet Sumathy

Omics technologies for understanding the plant–fungal endophyte interactions: crop improvement for future security

Tanvir Kaur, Rajeshwari Negi, Babita Sharma, Simranjeet Kaur, Sofia Sharief Khan, Divjot Kour, Sangram Singh, Sarvesh Rustagi, Sheikh Shreaz, Neelam Yadav, Manish Kumar, Ashutosh Kumar Rai, Ajar Nath Yadav

Colonization pattern of arbuscular mycorrhizal fungi in invasive plant species of tropical dry deciduous forest of Belgahna range of Central India

Sakshi Gautam, Bhaskar Chaurasia

Plant growth-promoting potential of Diaporthe osmanthi COFS1, an endophyte of Coleus forskohlii

Riya Dutta, Debdulal Banerjee,

First report of storage rot in yam (Dioscorea alata L.) caused by Junghuhnia sp. AK15 in Odisha and its in vitro biocontrol strategies

Akhtari Khatoon, Kunja Bihari Satapathy, Ashirbad Mohapatra

Multiorgan histopathological alterations in grass carp (Ctenopharyngodon idella) following azoxystrobin exposure

Gopal Anapana, Venkata Rathnamma Vakita

Integrated proteo-metabolomics reveal molecular mechanisms of wheat growth promotion and yield enhancement by PGPB–AMF microbial consortia under field conditions

Radheshyam Yadav, Pankaj Ror, Wusirika Ramakrishna

Synergistic effects of plant growth-promoting rhizobacteria–arbuscular mycorrhizal fungi consortium on restoring soil chemical properties in community-based artisanal gold mining sites

Salsa Rizqika Aulia, Dewi Wulandari, Ahdiar Fikri Maulana