Research Article | Volume: 7, Issue: 5, Sep-Oct, 2019

Screening and characterization of siderophore producing endophytic bacteria from Cicer arietinum and Pisum sativum plants

Rajat Maheshwari Namita Bhutani Pooja Suneja   

Open Access   

Published:  Sep 10, 2019

DOI: 10.7324/jabb.2019.70502
Abstract

Siderophores are low molecular weight iron chelating secondary metabolites synthesized by various groups of microorganisms help in scavenging iron-limited conditions. Siderophores produced by endophytic bacteria facilitate the plant growth by providing iron to plants. The objective of this study was to isolate and screen the siderophore producing endophytes from nodules and roots of Cicer arietinum and Pisum sativum plants. Out of total 84 isolates, only 14 endophytes produced siderophore and quantitative analysis was also done. Ten best siderophore producers (above 65% siderophore units) were characterized for the type of siderophore produced. Most of them were producing hydroxamate and carboxylate type of siderophores. These 10 isolates were evaluated for other plant growth promoting (PGP) traits in vitro. All of them were producing ammonia and indole-3-acetic acid (IAA). Isolate CPFR10 was found to be positive for all the PGP traits viz. ammonia, organic acid, HCN, and IAA production. Diversity analysis of these 10 isolates using Amplified rDNA Restriction Analysis profile revealed nine genotypes at 90% similarity.


Keyword:     Endophytes plant growth promotion siderophore CAS assay tetrazolium hydroxamate.


Citation:

Maheshwari R, Bhutani N, Suneja P. Screening and characterization of siderophore producing endophytic bacteria from Cicer arietinum and Pisum sativum plants. J Appl Biol Biotech. 2019;7(05):7–14.

Copyright: Author(s). This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike license.

HTML Full Text

1. INTRODUCTION

Iron is the fourth most abundant element in the Earth’s crust, vital for growth of living organisms as it acts as cofactor for enzymes involved in various metabolic processes [1,2]. Despite of its abundance in soil, it is unavailable to plants and microorganisms as it occurs as Fe3+ (ferric form) which is not soluble at physiological pH [3]. Microorganisms have developed specific mechanism for uptake of iron by releasing siderophores to scavenge iron. Siderophores are low molecular weight iron chelating compound which mainly functions to arrest insoluble ferric iron from different environments [4]. Large numbers of bacterial genera are known to synthesize siderophores, such as Pseudomonas, Azotobacter, Bacillus, Rhizobium, and Enterobacter. [5]. Although siderophores mainly scavenge iron but in addition to this, they have some other functions also. They help the microbes in acquiring mineral nutrients, function as virulence factors to protect them from pathogens [6,7].

Endophytes either fungi or bacteria resides inside plant tissues without causing any harm to their host [8]. They receive nutrients and protection from their host and in turn promote the growth of the host plant [9]. The plant growth promoting effect of endophytes occurs through the concerted activity of phytohormones production, biological nitrogen fixation, phosphate solubilization, modulation of 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase expression, production of siderophores, and biocontrol [10]. Among these, the siderophore production by endophytes helps the plants in iron sequestration and increases the concentration of bio available iron to inner tissues [11]. In addition to iron acquisition, they also give nutritional competition to the pathogens by limiting the iron availability to them and inhibit their growth [6]. Various studies have demonstrated the ability of siderophore producing endophytes in plant growth promotion. Upon inoculation of Mung bean plants with siderophore-producing Pseudomonas strain GRP3, chlorotic symptoms were reduced and chlorophyll content increased under iron-limiting environments [12]. The siderophore producing Pseudomonas fluorescens C7 facilitated the iron uptake and improved the growth of Arabidopsis thaliana plants [13]. Large number of studies have also reported siderophore producing endophytes lessen the environmental stresses forced on plants by high level of heavy metals in soil [14].

Siderophores, the metal-chelating agents produced by large number of bacteria under iron-destitute state, are mainly grouped into three types: hydroxamates, catecholates, and carboxylates [15]. Hydroxamate type of siderophore comprises linear and cyclic compound with 1-amino-5-hydroxaminopentane which binds to iron with binding constants of 1022 to 1032 M−1 [16]. Due to this robust binding and hexadentate structure, hydroxamates are unaffected to environmental degradation and enzymatic hydrolysis [16]. These types of siderophores are reported to be produced by both Gram-positive as well as Gram-negative bacterial genera, such as Streptomyces spp., aerobactin by Escherichia coli, ferrioxamines and ferribactin by Pseudomonas sp., Arthrobacter spp. [17]. Carboxylate type of siderophores like rhizobactin and staphyloferrin A are predominantly produced by Rhizobium and Staphylococcus, respectively. The catecholate (or phenolate) form of siderophore is known to be produced by bacterial genera, such as E. coli, Klebsiella sp., Bacillus sp., Erwinia sp., and Salmonella sp. [18]. For chelating iron, each catecholate group provides two oxygen atoms to form hexadentate octahedral complex. These types are characterized by high stability constants that can bind iron even at very low concentration. Most common examples are enterobaction, enterochelin, mycobactins, and agrobactins [2]. Therefore, the present investigation was planned to qualitatively and quantitatively screen siderophore producing endophytic bacteria from roots and nodules of Cicer arietinum and Pisum sativum plants and to study their genetic diversity using Amplified rDNA Restriction Analysis (ARDRA) profile.


2. MATERIALS AND METHODS

2.1. Collection of Plant Material and Isolation of Bacterial Endophytes

Cicer arietinum and Pisum sativum plant samples were collected randomly from the fields of Sirsa and Fatehabad district of Haryana, India. After uprooting plants, nodule and root samples were washed thoroughly in running tap water to remove any adhering soil. Samples were surface sterilized by sequential immersion in 0.25% HgCl2 for 1 minute, 95% ethanol for 30 seconds, then washing five times with sterile double distilled water [19]. Sterilized roots and nodules were crushed using sterile glass rod and sap was streaked on Tryptone soy agar (TSA) plates and incubated for 2–3 days at 28°C ± 2°C. Colonies were selected on the basis of variation in morphology (color, size, and shape), purified, maintained on agar slants at 4°C and glycerol stocks at −20°C.

2.2. Screening of Siderophore Production

The siderophore production capability of isolates was detected on Chrome azurol S (CAS) agar plates for qualitative assay [20]. Isolates were grown initially in tryptone soy broth (TSB) for 24 hours on rotatory shaker with 150 rpm at 28°C ± 2°C. Then 50µl of bacterial suspension was spotted on CAS agar plates and incubated for 4-5 days at 28±2°C. Following incubation, these plates were observed for production of yellow-orange halo zone around the spot which indicates siderophore production.

2.3. Quantitative Estimation of Siderophore Production

Isolates found to be positive for siderophore production were screened quantitatively using CAS liquid assay [21]. After initial growth in TSB, isolates were transferred to siderophore inducing medium (SIM) and incubated for 5 days on rotatory shaker with 200 rpm at 28±2°C. SIM was prepared as follows [22], Solution-1, 30.2 g of Piperazine-N,Nʹ-bis(2-ethanesulphonic acid) buffer dissolved in 750 ml of salts solution containing KH2PO4 (0.3 g), NaCl (0.5 g) and NH4Cl (1 g). Iron free solution-2 was prepared with glucose (2 g), mannitol (2 g), MgSO4.7H2O (493 mg), CaCl2 (11 mg), MnSO4.H2O (1.17 mg), H3BO3 (1.4 mg), CuSO4.5H2O (0.04 mg), ZnSO4.7H2O (1.2 mg), and NaMoO4.2H2O (1 mg). Solutions 1 and 2 were then autoclaved at 15 lb/inch2 for 15 minutes. Solution 3 was prepared by dissolving casamino acid (10% w/v) in distilled water, i.e., 3 g in 27 ml of water and dissolved thoroughly on magnetic stirrer. The solution was filter sterilized using 0.2 micron membrane filter. Finally, solutions 2 and 3 were mixed into solution 1 and volume was adjusted to 1 l with pH 6.8 and dispensed into flasks (50 ml per flask). All the glassware were deferrated by washing with 6-M HCl overnight to eliminate the residual Fe contamination, then rinsed with double distilled water two to three times. The solutions were deferrated using 8-hydroxyquinoline followed by extraction with chloroform. Following incubation of 5 days, cells were discarded by centrifugation at 7,000 rpm for 15 minutes. Resultant supernatant (0.5 ml) was mixed with the 0.5 ml CAS assay solution [21]; 10 μl of shuttle solution (2 M 5-sulfosalicyclic acid) was added. After 20 minutes of incubation at room temperature, absorbance was measured at 630 nm to estimate the loss of blue color to orange. The percentage of siderophore units were calculated by the formula:

[(ArAs)/Ar] × 100

where, Ar is the absorbance of reference sample at 630 nm (medium plus CAS assay solution and shuttle solution) and As is the absorbance of sample (supernatant plus CAS assay solution and shuttle solution).

2.4. Chemical Characterization of Siderophores

The type of siderophore was determined by specific tests using culture supernatants prepared as described above. Hydroxamate type of siderophore was detected by tetrazolium test [23] and spectrophotometric assay at 420–450 nm [24], catecholate type of siderophores was detected by Arnow’s test and spectrophotometric assay at 495 nm [24,25]; carboxylate type was detected using Shenker assay [26] and chemical test [27].

2.5. Characterization of Plant Growth Promoting Traits

Ammonia and organic acid production were evaluated by nesslerization reaction and methyl red test, respectively [28]. Phosphate solubilization was checked by spotting the isolate on Pikovskaya agar medium plates and incubated for 4–5 days at 28°C ± 2°C [29]. The plates were observed for the development of clear halo zone around colonies. Hydrogen cyanide (HCN) production was estimated using method as described by Lorck [30]. Bacterial isolates were spreaded on nutrient agar plates supplemented with glycine. Whatman filter paper no.1 disks (dipped in 0.5% picric acid, 2% of sodium carbonate) were placed on lids of the petri plates and sealed with the parafilm. Change in color from yellow to dark brown of the filter paper indicates the production of HCN after 4–5 days of incubation at 28°C ± 2°C. The production of IAA in the culture broth was determined by using standard colorimetric assay [31]. The isolates were grown in Erlenmeyer flasks (150 ml) containing 25 ml of sterilized Yeast extract mannitol (YEM) broth supplemented with 0.1 g/l L-tryptophan and incubated at 28°C ± 2°C for 5 days in a shaking incubator at 150 rpm. Following incubation, culture broths were centrifuged at 7,000 rpm for 3 minutes and the supernatant was mixed in equal volume with Salkowski reagent (1 ml 0.5M FeCl3 in 50 ml of 35% HClO4). After an incubation of 30 minutes in dark, absorbance was measured at 530 nm and IAA concentration of the samples was evaluated using standard curve of known concentration of IAA (10–200 µg/ml) [32]. Two milliliters of uninoculated YEM broth with 2 ml of Salkowski reagent was taken as a negative control.

2.6. Amplified rDNA Restriction Analysis (ARDRA) of Potent Siderophore Producers

The genomic DNA from selected isolates was extracted by modified CTAB method [33] and used as template for PCR amplification of 16S rDNA. The universal primers were used for amplification 8F (5ʹAGAGTTTGATCCTGGCTCAG3ʹ) and 1541R (5ʹAAGGAGGTGATCCAGCCGCA3ʹ) [34]. PCR amplifications were performed in a volume of 30 µl containing 50 ng DNA template, 1× Taq polymerase buffer, 0.25 µM of each primers, 0.2 mM of each dNTP, 1.5 mM MgCl2 and 1 U of Taq polymerase (Promega, USA). Amplification was performed in the thermocycler (Bio-Rad, T100, USA) with the initial denaturation of 94°C for 3 minutes followed by 30 cycles of 94°C for 45 seconds, 58°C for 45 seconds, 72°C for 2 minutes, and final extension of 72°C for 7 minutes. Amplified PCR product was resolved on 1.2% agarose gel in 0.5× TBE buffer at 60 V for 40 minutes stained with ethidium bromide under Azure c150 gel documentation system (Azure biosystems, Dublin, CA 94568). PCR products were digested separately with three restriction endonucleases HinfI, HaeIII, and MspI (Promega Corp., USA) in a 25-µl reaction volume. Restriction digested product were resolved on 1.5% agarose gels along with 100 bp marker (Promega Corp., USA) and run at 60 V in 1× tris-borate-EDTA (TBE) buffer containing 10 µg/ml ethidium bromide. Using SimQual (Jaccard coefficient), similarity matrices were constructed and clustering was done by unweighted pair grouping with mathematic average (UPGMA) method using NTSYS-pc program (Version2.1: Exeter software, Setauket, NY) [35].


3. RESULTS

3.1. Isolation of Bacterial Endophytes

A total of 84 morphologically distinct endophytic bacteria; 52 from Chickpea (Cicer arietinum) and 32 from Pea (Pisum sativum) plants were isolated from surface sterilized root and nodules and purified by subculturing. Forty-six isolates were obtained from nodules and 38 from roots. Out of total, 57% of the isolates were Gram-positive and rest Gram-negative (Tables 1 and 2). All the bacterial isolates exhibited variable colony and cell morphology.

3.2. Qualitative and Quantitative Screening of Siderophore Producing Endophytic Bacteria

Out of total, 14 isolates were found to be positive for siderophore and selected for quantitative estimation of siderophore production (Figs. 1 and 2). Four isolates produced siderophore units in the range of 1.44%–14.04%, while 10 isolates PFR5, CPFR10, CPFR4, CPFR18, PFR12, CPFN16, CPFN8, PFN14, CPFN11, and CPSR6 produced significantly higher quantities of siderophores above 65% siderophore units (Table 1).

3.3. Characterization of Type of Siderophore

Selected 10 bacterial isolates with significant siderophore production were characterized for type of siderophore produced (Table 2). Eight isolates, CPSR6, CPFN8, CPFN11, CPFN16, CPFR4, PFR5, PFR12, and PFN14 showed maximum peak between 420 and 450 nm in the FeCl3 test and deep red color in the tetrazolium test which indicates hydroxamate type of siderophore. Only one isolate, CPFR10 showed absorbance peak at 495 nm in the FeCl3 test and reddish color in Arnow’s assay indicated catecholate type of siderophore. Ten isolates, namely, CPSR6, CPFN8, CPFN11, CPFN16, CPFR4, CPFR10, CPFR18, PFR5, PFR12, and PFN14 were positive for carboxylate type of siderophore showed maximum peak between 190 and 280 nm. It was observed that isolates CPSR6, CPFN8, CPFN11, CPFN16, CPFR4, PFR5, PFR12, and PFN14 were positive for both the hydroxamate as well as carboxylate types of siderophore.

3.4. Plant Growth Promoting Properties of Siderophore Producing Endophytes

All these 10 siderophore producers were assessed for their plant growth promoting capability. All the isolates were able to produce IAA in the range of 11.12–68.46 µg/ml and ammonia. Only two isolate CPFR4 and PFR5 were able to solubilize phosphate. Isolate CPFR10 possessed multi plant growth promoting (PGP) traits and was found to be best ammonia, organic acid and IAA producer among all (Table 3).

Table 1: Percentage siderophore production by endophytic bacterial isolates from Cicer arietinum and Pisum sativum.

[Click here to view]

3.5. Amplification of 16S rDNA and ARDRA Profile Analysis

Genomic DNA of these isolates were amplified by PCR using 16S rDNA primers, fD1 (5ʹAGAGTTTGATCCTGGCTCAG3ʹ) and rD1 (5ʹ AAGGAGGTGATCCAGCC 3ʹ). Amplification of 16S rDNA was confirmed by obtaining single band of ~1,400 bp on 1.2% (w/v) agarose gel. The RFLP pattern of 16S rDNA of 10 selected bacterial isolates from chickpea and pea showed 24 polymorphic bands ranging from 170 to 1,300 bp. The dendrogram of similarity coefficients was constructed which depicted that all the isolates formed nine clusters at 90% similarity (Fig. 3). The isolates CPFN8, CPFR4 were grouped in cluster 1 showed 100% similarity, while all the other isolates were present in separate eight clusters. Isolate CPSR6 is out-grouped in the ninth clusters showing its variation with other isolates.

Table 2: Characterization of siderophore type by endophytic bacterial isolates.

[Click here to view]

Figure 1: Siderophore production by endophytic bacteria on CAS agar plates.

[Click here to view]

Figure 2: Chrome azurol S liquid assay to quantify siderophore production.

[Click here to view]

Table 3: PGP traits of best siderophore producers.

[Click here to view]

Figure 3: Dendrogram showing phenotypic similarity of siderophore producing endophytic bacteria from Cicer arietinum and Pisum sativum using UPGMA method.

[Click here to view]


4. DISCUSSION

Endophytic bacteria are ubiquitous in almost all the plant species; actively colonizing healthy plant tissue with no apparent symptoms of diseases [10]. They offer numerous benefits to host plant by producing primary and secondary metabolites, providing resistance against phytopathogens, augmenting tolerance to stress conditions and helping in sequestration of nutrients to plants [2]. The growing knowledge on the favorable effects of endophytes on plant growth has recognized these as useful tools on the way to improve crop yield in addition to more sustainable and chemical free agriculture. Several studies on rhizobial as well as non-rhizobial endophytic bacterial genera during the last two decades have acknowledged their role in plant growth promotion [12,13,36].

In this study, total of 84 endophytic bacterial isolates from nodules and roots of C. arietinum and P. sativum plants were screened for siderophore production. Fourteen isolates with most halozones diameters were selected and quantified. Production of siderophores is an important attribute of plant growth promoting endophytes and facilitates growth of plants under iron limiting conditions through iron sequestration [2]. There are many reports in literature on siderophore producing capacity of endophytes affirmed using CAS assay [3739].

Out of 14, 10 isolates were producing siderophore units above 65% in CAS-liquid assay. Siderophores produced by microorganisms are usually classified as catecholates, hydroxamates, carboxylates, and mixed type. A range of biochemical assays were used for determining siderophore type [23,24,40]. Most of our isolates were positive for hydroxamate type of siderophore. Earlier studies also reported that several soil bacteria could produce more than one type of hydroxamates [6]. The catecholate type of siderophore was detected by Arnow’s test and FeCl3 test. Only one of the isolate CPFR10 produced catecholate type of siderophore.

The carboxylate type of siderophores was detected by formation of copper complex between the range of 190–280 nm. In the present study, all the isolates showed peak in the range of 190–280 nm with copper colored complex showing the presence of carboxylate type of siderophore. The type of siderophore synthesized by bacteria depends on the amount and accessibility of nutrients and it may differ in culture rich conditions as compared to natural habitat. Previous studies have reported that the bacteria are capable of producing one or more types of siderophores, hydroxamate, and catecholate being the most common types [4143], but in contrary to this, our isolates produced both carboxylate and hydroxamate type of siderophores.The selected best 10 siderophore producers were further investigated for their in vitro plant growth promoting traits and diversity analysis. The ARDRA technique has been commonly used to study the molecular diversity of endophytic plant growth promoting bacteria. The genetic diversity of siderophore producing endophytic bacteria using ARDRA resulted in grouping of these isolates in nine separate clusters at 90% similarity representing nine different genotypes. Similarly, several biotypes of endophytic bacteria in different legumes crops have also been reported by others [5052]. Plant growth promoting ability of endophytes offers numerous benefits to host plant and help to survive under diverse environmental conditions [10,41,44]. Isolate CPFR10 was found to be most promising with multi PGP traits along with high IAA and HCN production. The ability to produce IAA promotes plant growth and elicits an increased level of protection during adverse conditions [45,46]. HCN production is regarded as one of the recognized host’s biocontrol or protecting mechanism against phytopathogens [47]. Several microorganisms producing siderophore along with HCN are known to suppress the growth of pathogens [4850]. The microbes having HCN+ phenotype along with siderophore and IAA production can be expected to have an ecological role not only in biocontrol but also in regulating the bioavailability of nutrients.


5. CONCLUSION

A total of 84 endophytic bacteria isolated from nodules and roots of Cicer arietinum and Pisum sativum plants were screened for siderophore production. Following qualitative CAS agar assay, 14 isolates produced siderophore and selected for further investigation. Upon quantitative analysis, 10 isolates produced siderophore above 65% siderophore units and subsequently characterized for the type of siderophore. Most of them produced both carboxylate and hydroxamate type of siderophores. The ability to produce different types of siderophores with differences in structure and iron binding/releasing capacities, enable these microbes to have multiple roles depending upon the habitats. The present investigation revealed that these endophytic bacterial isolates also exhibited other plant growth promoting traits viz. ammonia, organic acid, IAA, HCN production, and phosphate solubilization. However, to ascertain the effectivity of PGP traits on growth and productivity of crops, through phytohormone production and control against harmful microbes, needs to be evaluated in further studies.


ACKNOWLEDGMENTS

The authors would like to thank the Department of Science & Technology (DST), Govt. of India, New Delhi for financial support to undertake these investigations.


CONFLICT OF INTEREST

The authors declare that they have no conflict of interest.


REFERENCES

1. Gamit DA, Tank SK. Effect of siderophore producing microorganism on plant growth of Cajanus cajan (Pigeon pea). Int J Res Pure Appl Microbiol 2014;4:20–7.

2. Saha M, Sarkar S, Sarkar B, Sharma BK, Bhattacharjee S, Tribedi P. Microbial siderophores and their potential applications: a review. Environ Sci Pollut Res 2016;23:3984–99. CrossRef

3. Bou-Abdallah F. The iron redox and hydrolysis chemistry of the ferritins. Biochim Biophys Acta 2010;1800(8):719–31. CrossRef

4. Lacava PT, Silva-Stenico ME, Araújo WL, Simionato AVC, Carrilho E, Siu MT, et al. Detection of siderophores in endophytic bacteria Methylobacterium spp. associated with Xylella fastidiosa subsp. pauca. Pesqui Agropecu Bras 2008;43:521–8. CrossRef

5. Wittenwiler M. Mechanisms of iron mobilization by siderophores. Master Studies in Environmental Sciences Master, ETH Zürich, 2007.

6. Ahmed E, Holmström SJM. Siderophore production by microorganisms isolated from a Podzol soil profile. Geomicrobiol J 2015;32:397–411. CrossRef

7. Lamont BB, Pérez-Fernández M. Total growth and root-cluster production by legumes and proteas depends on rhizobacterial strain, host species and nitrogen level. Ann Bot 2016;118:725–32. CrossRef

8. Ryan RP, Germaine K, Franks A, Ryan DJ, Dowling DN. Bacterial endophytes: recent developments and applications. FEMS Microbiol Lett 2008;278:1–9. CrossRef

9. Dudeja SS, Giri R, Saini R, Suneja-Madan P, Kothe E. Interaction of endophytic microbes with legumes. J Basic Microbiol 2012;52:248–60. CrossRef

10. Santoyo G, Moreno-Hagelsieb G, del Carmen Orozco-Mosqueda M, Glick BR. Plant growth-promoting bacterial endophytes. Microbiol Res 2016;183:92–9. CrossRef

11. Dimkpa C. Microbial siderophores: production, detection and application in agriculture and environment. Endocytobiosis Cell Res 2016;27:7–16.

12. Sharma A, Johri BN, Sharma AK, Glick BR. Plant growth-promoting bacterium Pseudomonas sp. strain GRP3influences iron acquisition in mung bean (Vigna radiata L. Wilzeck). Soil Biol Biochem 2003;35:887–94. CrossRef

13. Vansuyt G, Robin A, Briat JF, Curie C, Lemanceau P. Iron acquisition from Fe-pyoverdine by Arabidopsis thaliana. Mol Plant Microbe Interact 2007;20(4):441–7. CrossRef

14. Burd GI, Dixon DG, Glick BR. Plant growth-promoting bacteria that decrease heavy metal toxicity in plants. Can J Microbiol 2000;46(3):237–45. CrossRef

15. Rungin S, Indananda C, Suttiviriya P, Kruasuwan W, Jaemsaeng R, Thamchaipenet A. Plant growth enhancing effects by a siderophore-producing endophytic streptomycete isolated from a Thai jasmine rice plant (Oryza sativa L. cv. KDML105). Int J Gen Mol Microbiol 2012;102:463–72. CrossRef

16. Winkelmann G. Ecology of siderophores with special reference to the fungi. Biometals 2007;20(3–4):379. CrossRef

17. Cornelis P. Iron uptake and metabolism in pseudomonads. App microbiol Biot 2010;86(6):1637–45. CrossRef

18. Crosa JH, Mey AR, Payne SM, editors. Iron transport in bacteria. ASM Press, Washington, DC, 2004.

19. Vincent JM. A Manual for the Practical Study of Root-Nodule Bacteria. Blackwell Scientific Publications, Oxford Press, Edinburgh; 1970.

20. Schwyn B, Neilands JB. Universal chemical assay for the detection and determination of siderophores. Anal Biochem 1987;160:47–56. CrossRef

21. Payne SM. Detection, isolation, and characterization of siderophores. Methods Enzymol 1994;235:329–44. CrossRef

22. Alexander DB, Zuberer DA. Use of chrome azurol S reagents to evaluate siderophore production by rhizosphere bacteria. Biol Fertil Soils 1991;12:39–45. CrossRef

23. Snow GA. Mycobactin. A growth factor for Mycobacterium johnei. Part II. Degradation, and identification of fragments. J Chem Soc (Resumed) 1954;2588–96. CrossRef

24. Neilands JB. Microbial Iron Compounds. Annu Rev Biochem 1981; 50:715–731. CrossRef

25. Arnow L. Colorimetric determination of the components of 3, 4-dihydroxyphenylalaninetyrosine mixtures. J Biol Chem 1937;118: 531–537.

26. Shenker M, Chen Y, Oliver I, Helmann M, Hadar Y. Utilization by tomatoes of iron mediated by a siderophore produced by Rhizopus arrhizus. J Plant Nutr 1992;15:2173–82. CrossRef

27. Vogel AL. Class reactions (reactions for functional groups). In: Elementary practical organic chemislly. CBS Publishers, New Delhi, p. 190, 1992.

28. Cappucino JC, Sherman N. In: Microbiology: a laboratory manual. 3rd edition, Benjamin/Cumming Pub. Co., New York, NY, 1992.

29. Pikovskaya RI. Mobilization of phosphorus in soil in connection with vital activity of some microbial species. Mikrobiologiya 1948;17:362–70.

30. Lorck H. Production of hydrocyanic acid by bacteria. Physiol Plant 1948;1:142–6. CrossRef

31. Tang YW, Bonner J. The enzymatic inactivation of indole acetic acid. II. The physiology of the enzyme. Am J Bot 1948;35:570–8. CrossRef

32. Gordon SA, Weber RP. Colorimetric estimation of inodoleacetic acid. Plant Physiol 1951;26:192–5. CrossRef

33. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, et al. Short protocols in molecular biology. Chap 2.4. Wiley, New York, 1995.

34. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 1991;173:697–703. CrossRef

35. Rohlf FJ. On applications of geometric morphometrics to studies of ontogeny and phylogeny. Syst Biol 1998;47:147–58. CrossRef

36. Saini R, Kumar V, Dudeja SS, Pathak DV. Beneficial effects of inoculation of endophytic bacterial isolates from roots and nodules in Chickpea. Int J Curr Microbiol Appl Sci 2015;4:207–21.

37. Liaqat F, Eltem R. Identification and characterization of endophytic bacteria isolated from in vitro cultures of peach and pear rootstocks. 3 Biotech 2016;6:2–9. CrossRef

38. Ghavami N, Alikhani HA, Pourbabaei AA, Besharati H. Effects of two new siderophore-producing rhizobacteria on growth and iron content of maize and canola plants. J Plant Nutr 2017;40:736–46. CrossRef

39. Rashid S, Charles TC, Glick BR. Isolation and characterization of new plant growth-promoting bacterial endophytes. Appl Soil Ecol 2012;61:217–24. CrossRef

40. Dave BP, Dube HC. Detection and chemical characterisation of siderophores of rhizobacterial fluorescent Pseudomonas. Indian Phytopathol 2000;53:97–8.

41. Farokh RZ, Sachdev D, Pour NK, Engineer A, Pardesi KR, Zinjarde S, et al. Characterization of plant-growth-promoting traits of Acinetobacter species isolated from rhizosphere of Pennisetum glaucum. J Microbiol Biotechnol 2011;21:556–66.

42. Kumar P, Thakur S, Dhingra GK, Singh A, Pal MK, Harshvardhan K, et al. Inoculation of siderophore producing rhizobacteria and their consortium for growth enhancement of wheat plant. Biocatal Agric Biotechnol 2018;15:264–9. CrossRef

43. Khan A, Singh P, Srivastava A. Synthesis, nature and utility of universal iron chelator—Siderophore: a review. Microbiol Res 2018;212–3, 103–11. CrossRef

44. Gaiero JR, McCall CA, Thompson KA, Day NJ, Best AS, Dunfield KE. Inside the root microbiome: Bacterial root endophytes and plant growth promotion. Am J Bot 2013;100:1738–50. CrossRef

45. Defez R, Andreozzi A, Bianco C. The overproduction of indole-3-acetic acid (IAA) in endophytes upregulates nitrogen fixation in both bacterial cultures and inoculated rice plants. Microb Ecol 2017;74:441–52. CrossRef

46. Bhutani N, Maheshwari R, Negi M, and Suneja P. Optimization of IAA production by endophytic Bacillus spp . from Vigna radiata for their potential use as plant growth promoters. Isr J Plant Sci 2018; 65:1–2. CrossRef

47. Passari AK, Mishra VK, Leo VV, Gupta VK, Singh BP. Phytohormone production endowed with antagonistic potential and plant growth promoting abilities of culturable endophytic bacteria isolated from Clerodendrum colebrookianum Walp. Microbiol Res 2016;193:57–73. CrossRef

48. Rijavec T, Lapanje A. Cyanogenic Pseudomonas spp. strains are concentrated in the rhizosphere of alpine pioneer plants. Microbiol Res 2017;194:20–8. CrossRef

49. Blumer C, Haas D. Mechanism, regulation, and ecological role of bacterial cyanide biosynthesis. Arch Microbiol 2000;173(3):170–7. CrossRef

50. Bhutani N, Maheshwari R, Suneja P. Isolation and characterization of plant growth promoting endophytic bacteria isolated from Vigna radiata. Indian J Agric Res 2018;52(6):596–603.

51. Kumar V, Vir Pathak D, Singh Dudeja S, Saini R, Giri R, Narula S, et al. Legume nodule endophytes more diverse than endophytes from roots of legumes or non legumes in soils of Haryana, India. J Microbiol Biotechnol 2013;3:83–92.

52. Kuklinsky-Sobral J, Araújo WL, Mendes R, Geraldi IO, Pizzirani-Kleiner AA, Azevedo JL. Isolation and characterization of soybean-associated bacteria and their potential for plant growth promotion. Environ. Microbiol. 2004; 6(12):1244–1251.

Reference

1. Gamit, D A; Tank SK. Effect of Siderophore Producing Microorganism on Plant Growth of Cajanus cajan ( Pigeon pea ). Int J Res Pure Appl Microbiol 2014; 4:20-27.

2. Saha M, Sarkar S, Sarkar B, Sharma BK, Bhattacharjee S, and Tribedi P. Microbial siderophores and their potential applications: a review. Environ Sci Pollut Res 2016; 23:3984-3999. https://doi.org/10.1007/s11356-015-4294-0

3. Bou-Abdallah F. The iron redox and hydrolysis chemistry of the ferritins. Biochimica et Biophysica Acta - General Subjects. 2010. https://doi.org/10.1016/j.bbagen.2010.03.021

4. Lacava PT, Silva-Stenico ME, Araújo WL, Simionato AVC, Carrilho E, Siu MT, et al. Detection of siderophores in endophytic bacteria Methylobacterium spp. associated with Xylella fastidiosa subsp. pauca. Pesqui Agropecu Bras 2008; 43:521-528. https://doi.org/10.1590/S0100-204X2008000400011

5. Wittenwiler M. Mechanisms of Iron Mobilization by Siderophores. Environ Sci 2007.

6. Ahmed E and Holmström SJM. Siderophore Production by Microorganisms Isolated From a Podzol Soil Profile. Geomicrobiol J 2015; 32:397-411. https://doi.org/10.1080/01490451.2014.925011

7. Lamont BB and Pérez-Fernández M. Total growth and root-cluster production by legumes and proteas depends on rhizobacterial strain, host species and nitrogen level. Ann Bot 2016; 118:725-732. https://doi.org/10.1093/aob/mcw090

8. Ryan RP, Germaine K, Franks A, Ryan DJ, and Dowling DN. Bacterial endophytes: Recent developments and applications. FEMS Microbiol Lett 2008; 278:1-9. https://doi.org/10.1111/j.1574-6968.2007.00918.x

9. Dudeja SS, Giri R, Saini R, Suneja-Madan P, and Kothe E. Interaction of endophytic microbes with legumes. J Basic Microbiol 2012; 52:248-260. https://doi.org/10.1002/jobm.201100063

10. Santoyo G, Moreno-Hagelsieb G, del Carmen Orozco-Mosqueda M, and Glick BR. Plant growth-promoting bacterial endophytes. Microbiol Res 2016; 183:92-99. https://doi.org/10.1016/j.micres.2015.11.008

11. Dimkpa C. Microbial siderophores: Production, detection and application in agriculture and environment. Endocytobiosis Cell Res 2016; 27:7-16.

12. Sharma A, Johri BN, Sharma AK, and Glick BR. Plant growth-promoting bacterium Pseudomonas sp. strain GRP3influences iron acquisition in mung bean (Vigna radiata L. Wilzeck). Soil Biol Biochem 2003; 35:887-894. https://doi.org/10.1016/S0038-0717(03)00119-6

13. Vansuyt G, Robin A, Briat JF, Curie C, and Lemanceau P. Iron acquisition from Fe-pyoverdine by Arabidopsis thaliana. Mol Plant-Microbe Interact 2007. https://doi.org/10.1094/MPMI-20-4-0441

14. Burd GI, Dixon DG, and Glick BR. Plant growth-promoting bacteria that decrease heavy metal toxicity in plants. Can J Microbiol 2000. https://doi.org/10.1139/w99-143

15. Rungin S, Indananda C, Suttiviriya P, Kruasuwan W, Jaemsaeng R, and Thamchaipenet A. Plant growth enhancing effects by a siderophore-producing endophytic streptomycete isolated from a Thai jasmine rice plant (Oryza sativa L. cv. KDML105). Antonie van Leeuwenhoek, Int J Gen Mol Microbiol 2012; 102:463-472. https://doi.org/10.1007/s10482-012-9778-z

16. Winkelmann G. Ecology of siderophores with special reference to the fungi. In: BioMetals. 2007. https://doi.org/10.1007/s10534-006-9076-1

17. Cornelis P. Iron uptake and metabolism in pseudomonads. Applied Microbiology and Biotechnology. 2010. https://doi.org/10.1007/s00253-010-2550-2

18. Mey AR, Crosa JH, and Payne SM. Iron Transport in Bacteria. Iron Transport in Bacteria. American Society of Microbiology; 2004.

19. Vincent JM. A Manual for the Practical Study of Root-Nodule Bacteria. International Biological Programme handbook. 1970.

20. Schwyn B and Neilands JB. Universal chemical assay for the detection and determination of siderophores. Anal Biochem 1987; 160:47-56. https://doi.org/10.1016/0003-2697(87)90612-9

21. Payne SM. Detection, isolation, and characterization of siderophores. Methods Enzymol 1994; 235:329-344. https://doi.org/10.1016/0076-6879(94)35151-1

22. Alexander DB and Zuberer DA. Use of chrome azurol S reagents to evaluate siderophore production by rhizosphere bacteria. Biol Fertil Soils 1991; 12:39-45. https://doi.org/10.1007/BF00369386

23. Snow GA. Mycobactin. A growth factor for Mycobacterium johnei. Part II. Degradation, and identification of fragments. J Chem Soc 1954. https://doi.org/10.1039/jr9540002588

24. Neilands JB. Microbial Iron Compounds. Annu Rev Biochem 1981. https://doi.org/10.1146/annurev.bi.50.070181.003435

25. Arnow L. Colorimetric determination of the components of 3, 4-dihydroxyphenylalaninetyrosine mixtures. J Biol Chem 1937.

26. Shenker M, Chen Y, Oliver I, Helmann M, and Hadar Y. Utilization by tomatoes of iron mediated by a siderophore produced by rhizopus arrhizus. J Plant Nutr 1992; 15:2173-2182. https://doi.org/10.1080/01904169209364466

27. Vogel A L, Class reactions (reactions for functional groups), in Elementary practical organic chemislly (CBS Publishers, New Delhi) 1992; 190.

28. Cappucino JC, Sherman N. In: Microbiology: a laboratory manual. 3rd ed. New York: Benjamin/Cumming Pub. Co.; 1992.

29. Pikovskaya and RI. Mobilization of phosphorus in soil in connection with vital activity of some microbial species. Mikrobiologiya 1948; 17:362-370.

30. Lorck H. Production of Hydrocyanic Acid by Bacteria. Physiol Plant 1948; 1:142-146. https://doi.org/10.1111/j.1399-3054.1948.tb07118.x

31. Tang YW and Bonner J. The enzymatic inactivation of indole acetic acid; the physiology of the. Am J Bot 1948; 35:570-578. https://doi.org/10.1002/j.1537-2197.1948.tb08123.x

32. Gordon SA and Weber RP. Colorimetric Estimation of Inodoleacetic Acid. Plant Physiol 1951; 26:192-195. https://doi.org/10.1104/pp.26.1.192

33. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. Short protocols in molecular biology; 1995; Chap 2.4. Wiley, New York

34. Weisburg WG, Barns SM, Pelletier DA, and Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 1991; 173:697-703. https://doi.org/10.1128/jb.173.2.697-703.1991

35. Rohlf FJ. On Applications of Geometric Morphometrics to Studies of Ontogeny and Phylogeny. Syst Biol 1998; 47:147-158. https://doi.org/10.1080/106351598261094

36. Saini R, Kumar V, Dudeja SS, and Pathak D V. Beneficial Effects of Inoculation of Endophytic Bacterial Isolates from Roots and Nodules in Chickpea. Int J Curr Microbiol Appl Sci 2015; 4:207-221.

37. Liaqat F and Eltem R. Identification and characterization of endophytic bacteria isolated from in vitro cultures of peach and pear rootstocks. 3 Biotech 2016; 6:2-9. https://doi.org/10.1007/s13205-016-0442-6

38. Ghavami N, Alikhani HA, Pourbabaei AA, and Besharati H. Effects of two new siderophore-producing rhizobacteria on growth and iron content of maize and canola plants. J Plant Nutr 2017; 40:736-746. https://doi.org/10.1080/01904167.2016.1262409

39. Rashid S, Charles TC, and Glick BR. Isolation and characterization of new plant growth-promoting bacterial endophytes. Appl Soil Ecol 2012; 61:217-224. https://doi.org/10.1016/j.apsoil.2011.09.011

40. Dave BP and Dube HC. Detection and Chemical Characterisation of Siderophores of Rhizobacterial Fluorescent Pseudomonas. Indian Phytopathol 2000; 53:97-98.

41. Farokh RZ, Sachdev D, Pour NK, Engineer A, Pardesi KR, Zinjarde S, et al. Characterization of plant-growth-promoting traits of Acinetobacter species isolated from rhizosphere of Pennisetum glaucum. J Microbiol Biotechnol 2011; 21:556-566.

42. Kumar P, Thakur S, Dhingra GK, Singh A, Pal MK, Harshvardhan K, et al. Inoculation of siderophore producing rhizobacteria and their consortium for growth enhancement of wheat plant. Biocatal Agric Biotechnol 2018; 15:264-269. https://doi.org/10.1016/j.bcab.2018.06.019

43. Khan A, Singh P, and Srivastava A. Synthesis, nature and utility of universal iron chelator - Siderophore: A review. Microbiol Res 2018; 212-213:103-111. https://doi.org/10.1016/j.micres.2017.10.012

44. Gaiero JR, McCall CA, Thompson KA, Day NJ, Best AS, and Dunfield KE. Inside the root microbiome: Bacterial root endophytes and plant growth promotion. Am J Bot 2013; 100:1738-1750. https://doi.org/10.3732/ajb.1200572

45. Defez R, Andreozzi A, and Bianco C. The Overproduction of Indole-3-Acetic Acid (IAA) in Endophytes Upregulates Nitrogen Fixation in Both Bacterial Cultures and Inoculated Rice Plants. Microb Ecol 2017; 74:441-452. https://doi.org/10.1007/s00248-017-0948-4

46. Bhutani N, Maheshwari R, Negi M, and Suneja P. Optimization of IAA production by endophytic Bacillus spp . from Vigna radiata for their potential use as plant growth promoters. 2018; 65:1-2. https://doi.org/10.1163/22238980-00001025

47. Passari AK, Mishra VK, Leo VV, Gupta VK, and Singh BP. Phytohormone production endowed with antagonistic potential and plant growth promoting abilities of culturable endophytic bacteria isolated from Clerodendrum colebrookianum Walp. Microbiol Res 2016; 193:57-73. https://doi.org/10.1016/j.micres.2016.09.006

48. Rijavec T and Lapanje A. Cyanogenic Pseudomonas spp. strains are concentrated in the rhizosphere of alpine pioneer plants. Microbiol Res 2017; 194:20-28. https://doi.org/10.1016/j.micres.2016.09.001

49. Blumer C and Haas D. Mechanism, regulation, and ecological role of bacterial cyanide biosynthesis. Arch Microbiol 2000. https://doi.org/10.1007/s002039900127

50. Bhutani N, Maheshwari R, and Suneja P. Isolation and characterization of plant growth promoting endophytic bacteria isolated from Vigna radiata. Indian J Agric Res 2018; 52(6): 596-603.

1. Gamit, D A; Tank SK. Effect of Siderophore Producing Microorganism on Plant Growth of Cajanus cajan ( Pigeon pea ). Int J Res Pure Appl Microbiol 2014; 4:20-27.

2. Saha M, Sarkar S, Sarkar B, Sharma BK, Bhattacharjee S, and Tribedi P. Microbial siderophores and their potential applications: a review. Environ Sci Pollut Res 2016; 23:3984-3999. https://doi.org/10.1007/s11356-015-4294-0

3. Bou-Abdallah F. The iron redox and hydrolysis chemistry of the ferritins. Biochimica et Biophysica Acta - General Subjects. 2010. https://doi.org/10.1016/j.bbagen.2010.03.021

4. Lacava PT, Silva-Stenico ME, Araújo WL, Simionato AVC, Carrilho E, Siu MT, et al. Detection of siderophores in endophytic bacteria Methylobacterium spp. associated with Xylella fastidiosa subsp. pauca. Pesqui Agropecu Bras 2008; 43:521-528. https://doi.org/10.1590/S0100-204X2008000400011

5. Wittenwiler M. Mechanisms of Iron Mobilization by Siderophores. Environ Sci 2007.

6. Ahmed E and Holmström SJM. Siderophore Production by Microorganisms Isolated From a Podzol Soil Profile. Geomicrobiol J 2015; 32:397-411. https://doi.org/10.1080/01490451.2014.925011

7. Lamont BB and Pérez-Fernández M. Total growth and root-cluster production by legumes and proteas depends on rhizobacterial strain, host species and nitrogen level. Ann Bot 2016; 118:725-732. https://doi.org/10.1093/aob/mcw090

8. Ryan RP, Germaine K, Franks A, Ryan DJ, and Dowling DN. Bacterial endophytes: Recent developments and applications. FEMS Microbiol Lett 2008; 278:1-9. https://doi.org/10.1111/j.1574-6968.2007.00918.x

9. Dudeja SS, Giri R, Saini R, Suneja-Madan P, and Kothe E. Interaction of endophytic microbes with legumes. J Basic Microbiol 2012; 52:248-260. https://doi.org/10.1002/jobm.201100063

10. Santoyo G, Moreno-Hagelsieb G, del Carmen Orozco-Mosqueda M, and Glick BR. Plant growth-promoting bacterial endophytes. Microbiol Res 2016; 183:92-99. https://doi.org/10.1016/j.micres.2015.11.008

11. Dimkpa C. Microbial siderophores: Production, detection and application in agriculture and environment. Endocytobiosis Cell Res 2016; 27:7-16.

12. Sharma A, Johri BN, Sharma AK, and Glick BR. Plant growth-promoting bacterium Pseudomonas sp. strain GRP3influences iron acquisition in mung bean (Vigna radiata L. Wilzeck). Soil Biol Biochem 2003; 35:887-894. https://doi.org/10.1016/S0038-0717(03)00119-6

13. Vansuyt G, Robin A, Briat JF, Curie C, and Lemanceau P. Iron acquisition from Fe-pyoverdine by Arabidopsis thaliana. Mol Plant-Microbe Interact 2007. https://doi.org/10.1094/MPMI-20-4-0441

14. Burd GI, Dixon DG, and Glick BR. Plant growth-promoting bacteria that decrease heavy metal toxicity in plants. Can J Microbiol 2000. https://doi.org/10.1139/w99-143

15. Rungin S, Indananda C, Suttiviriya P, Kruasuwan W, Jaemsaeng R, and Thamchaipenet A. Plant growth enhancing effects by a siderophore-producing endophytic streptomycete isolated from a Thai jasmine rice plant (Oryza sativa L. cv. KDML105). Antonie van Leeuwenhoek, Int J Gen Mol Microbiol 2012; 102:463-472. https://doi.org/10.1007/s10482-012-9778-z

16. Winkelmann G. Ecology of siderophores with special reference to the fungi. In: BioMetals. 2007. https://doi.org/10.1007/s10534-006-9076-1

17. Cornelis P. Iron uptake and metabolism in pseudomonads. Applied Microbiology and Biotechnology. 2010. https://doi.org/10.1007/s00253-010-2550-2

18. Mey AR, Crosa JH, and Payne SM. Iron Transport in Bacteria. Iron Transport in Bacteria. American Society of Microbiology; 2004.

19. Vincent JM. A Manual for the Practical Study of Root-Nodule Bacteria. International Biological Programme handbook. 1970.

20. Schwyn B and Neilands JB. Universal chemical assay for the detection and determination of siderophores. Anal Biochem 1987; 160:47-56. https://doi.org/10.1016/0003-2697(87)90612-9

21. Payne SM. Detection, isolation, and characterization of siderophores. Methods Enzymol 1994; 235:329-344. https://doi.org/10.1016/0076-6879(94)35151-1

22. Alexander DB and Zuberer DA. Use of chrome azurol S reagents to evaluate siderophore production by rhizosphere bacteria. Biol Fertil Soils 1991; 12:39-45. https://doi.org/10.1007/BF00369386

23. Snow GA. Mycobactin. A growth factor for Mycobacterium johnei. Part II. Degradation, and identification of fragments. J Chem Soc 1954. https://doi.org/10.1039/jr9540002588

24. Neilands JB. Microbial Iron Compounds. Annu Rev Biochem 1981. https://doi.org/10.1146/annurev.bi.50.070181.003435

25. Arnow L. Colorimetric determination of the components of 3, 4-dihydroxyphenylalaninetyrosine mixtures. J Biol Chem 1937.

26. Shenker M, Chen Y, Oliver I, Helmann M, and Hadar Y. Utilization by tomatoes of iron mediated by a siderophore produced by rhizopus arrhizus. J Plant Nutr 1992; 15:2173-2182. https://doi.org/10.1080/01904169209364466

27. Vogel A L, Class reactions (reactions for functional groups), in Elementary practical organic chemislly (CBS Publishers, New Delhi) 1992; 190.

28. Cappucino JC, Sherman N. In: Microbiology: a laboratory manual. 3rd ed. New York: Benjamin/Cumming Pub. Co.; 1992.

29. Pikovskaya and RI. Mobilization of phosphorus in soil in connection with vital activity of some microbial species. Mikrobiologiya 1948; 17:362-370.

30. Lorck H. Production of Hydrocyanic Acid by Bacteria. Physiol Plant 1948; 1:142-146. https://doi.org/10.1111/j.1399-3054.1948.tb07118.x

31. Tang YW and Bonner J. The enzymatic inactivation of indole acetic acid; the physiology of the. Am J Bot 1948; 35:570-578. https://doi.org/10.1002/j.1537-2197.1948.tb08123.x

32. Gordon SA and Weber RP. Colorimetric Estimation of Inodoleacetic Acid. Plant Physiol 1951; 26:192-195. https://doi.org/10.1104/pp.26.1.192

33. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. Short protocols in molecular biology; 1995; Chap 2.4. Wiley, New York

34. Weisburg WG, Barns SM, Pelletier DA, and Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 1991; 173:697-703. https://doi.org/10.1128/jb.173.2.697-703.1991

35. Rohlf FJ. On Applications of Geometric Morphometrics to Studies of Ontogeny and Phylogeny. Syst Biol 1998; 47:147-158. https://doi.org/10.1080/106351598261094

36. Saini R, Kumar V, Dudeja SS, and Pathak D V. Beneficial Effects of Inoculation of Endophytic Bacterial Isolates from Roots and Nodules in Chickpea. Int J Curr Microbiol Appl Sci 2015; 4:207-221.

37. Liaqat F and Eltem R. Identification and characterization of endophytic bacteria isolated from in vitro cultures of peach and pear rootstocks. 3 Biotech 2016; 6:2-9. https://doi.org/10.1007/s13205-016-0442-6

38. Ghavami N, Alikhani HA, Pourbabaei AA, and Besharati H. Effects of two new siderophore-producing rhizobacteria on growth and iron content of maize and canola plants. J Plant Nutr 2017; 40:736-746. https://doi.org/10.1080/01904167.2016.1262409

39. Rashid S, Charles TC, and Glick BR. Isolation and characterization of new plant growth-promoting bacterial endophytes. Appl Soil Ecol 2012; 61:217-224. https://doi.org/10.1016/j.apsoil.2011.09.011

40. Dave BP and Dube HC. Detection and Chemical Characterisation of Siderophores of Rhizobacterial Fluorescent Pseudomonas. Indian Phytopathol 2000; 53:97-98.

41. Farokh RZ, Sachdev D, Pour NK, Engineer A, Pardesi KR, Zinjarde S, et al. Characterization of plant-growth-promoting traits of Acinetobacter species isolated from rhizosphere of Pennisetum glaucum. J Microbiol Biotechnol 2011; 21:556-566.

42. Kumar P, Thakur S, Dhingra GK, Singh A, Pal MK, Harshvardhan K, et al. Inoculation of siderophore producing rhizobacteria and their consortium for growth enhancement of wheat plant. Biocatal Agric Biotechnol 2018; 15:264-269. https://doi.org/10.1016/j.bcab.2018.06.019

43. Khan A, Singh P, and Srivastava A. Synthesis, nature and utility of universal iron chelator - Siderophore: A review. Microbiol Res 2018; 212-213:103-111. https://doi.org/10.1016/j.micres.2017.10.012

44. Gaiero JR, McCall CA, Thompson KA, Day NJ, Best AS, and Dunfield KE. Inside the root microbiome: Bacterial root endophytes and plant growth promotion. Am J Bot 2013; 100:1738-1750. https://doi.org/10.3732/ajb.1200572

45. Defez R, Andreozzi A, and Bianco C. The Overproduction of Indole-3-Acetic Acid (IAA) in Endophytes Upregulates Nitrogen Fixation in Both Bacterial Cultures and Inoculated Rice Plants. Microb Ecol 2017; 74:441-452. https://doi.org/10.1007/s00248-017-0948-4

46. Bhutani N, Maheshwari R, Negi M, and Suneja P. Optimization of IAA production by endophytic Bacillus spp . from Vigna radiata for their potential use as plant growth promoters. 2018; 65:1-2. https://doi.org/10.1163/22238980-00001025

47. Passari AK, Mishra VK, Leo VV, Gupta VK, and Singh BP. Phytohormone production endowed with antagonistic potential and plant growth promoting abilities of culturable endophytic bacteria isolated from Clerodendrum colebrookianum Walp. Microbiol Res 2016; 193:57-73. https://doi.org/10.1016/j.micres.2016.09.006

48. Rijavec T and Lapanje A. Cyanogenic Pseudomonas spp. strains are concentrated in the rhizosphere of alpine pioneer plants. Microbiol Res 2017; 194:20-28. https://doi.org/10.1016/j.micres.2016.09.001

49. Blumer C and Haas D. Mechanism, regulation, and ecological role of bacterial cyanide biosynthesis. Arch Microbiol 2000. https://doi.org/10.1007/s002039900127

50. Bhutani N, Maheshwari R, and Suneja P. Isolation and characterization of plant growth promoting endophytic bacteria isolated from Vigna radiata. Indian J Agric Res 2018; 52(6): 596-603.

Article Metrics
1359 Views 940 Downloads 2299 Total

Year

Month

Related Search

By author names

Similar Articles

Biodiversity and biotechnological applications of halophilic microbes for sustainable agriculture

Ajar Nath Yadav, Anil Kumar Saxena

Bioprospecting of endophytic bacteria from the Indian Himalayas and their role in plant growth promotion of maize (Zea mays L.)

Kusam Lata Rana, Divjot Kour, Tanvir Kaur, Rubee Devi, Ashok Yadav, Ajar Nath Yadav

Bacterial endophytes from halophyte black saxaul (Haloxylon aphyllum Minkw.) and their plant growth-promoting properties

Vyacheslav Shurigin,, Begali Alikulov, Kakhramon Davranov, Zafar Ismailov

Arbuscular mycorrhizal fungi as a potential biofertilizers for agricultural sustainability

Kumar Anand, Gaurav Kumar Pandey, Tanvir Kaur, Olivia Pericak, Collin Olson, Rajinikanth Mohan, Kriti Akansha, Ashok Yadav, Rubee Devi, Divjot Kour, Ashutosh Kumar Rai, Manish Kumar, Ajar Nath Yadav

Phosphate-Solubilizing Microorganisms for Agricultural Sustainability

Ajar Nath Yadav

Potassium Solubilizing Microorganisms for Agricultural Sustainability

Ajar Nath Yadav

Stress Adaptive Phosphorus Solubilizing Microbiomes for Agricultural Sustainability

Divjot Kour, Ajar Nath Yadav

Microbial diversity of Azadirachta indica (Neem) gum: An unexplored niche

Pragya Saxena,, Hillol Chakdar, Arjun Singh, Sheetal Shirodkar, Alok K. Srivastava

Rhizospheres of Rubus ellipticus and Ageratina riparia from Meghalaya exhibit Actinomycetota that promote plant growth

Debulman Syiemiong, Dhruva Kumar Jha, Samrat Adhikari, Dapkupar Mylliemngap, Richborn Kharbuki, Dominic Lyngdoh, Joel Paul Warlarpih, Neha Paul, Kevin Matthew Lamare, Chalcedony Wahlang, Rangehbok Lyngkhoi

Minerals Solubilizing Microbes for Agricultural Sustainability

Ajar Nath Yadav

Phyllospheric microbiomes for agricultural sustainability

Ajar Nath Yadav,

Harnessing multifunctional drought adaptive phosphorus solubilizing microbes for resilient agro-ecosystems

Divjot Kour, Tanvir Kaur, Ajar Nath Yadav,

Evaluation of chromium stress tolerance in endophytic bacteria isolated from chickpea root nodules and their plant growth-promoting traits

Sudipta Majhi, Mausumi Sikdar

Plant growth promotion activity of endophytic bacteria isolated from Acalypha indica L., Euphorbiaceae

Anjitha Manoj, Arundathi Punathil, Anilkumar Madhavan Nair

Screening and evaluation of PGPR strains having multiple PGP traits from hilly terrain

Teg Bahadur Singh, Vikram Sahai, Akbar Ali, Mrinalini Prasad, Arti Yadav, Preksha Shrivastav, Deepika Goyal, Prem Kumar Dantu

Applications of bacterial endophytes and their advanced identification methodologies

R. Renugadevi, M. P. Ayyappadas, V. Subha Priya, M. Flory Shobana, K. Vivekanandhan

Evaluation of plant growth-promoting activities of endophytic bacteria of Musa acuminata and their characterization

Shilpi Singh, Kamlesh Choure, Piyush Kant Rai, Sourabh Singh Gour, Vivek Kumar Agnihotri

Plant growth-promoting Pseudomonas spp. from jasmine rhizosphere as a sustainable alternative to agrochemicals

Ramya Rai Mundala,, Raghavendra Rao Badkillaya

Triphala extract Reduces Anti-apoptotic Protein (Mcl-1) Expression through the Activation of Caspase 3 in Hepatocellular Carcinoma Cells

Yoganchal Mishra, Rohit Raj Yadav, Kavita Verma, Neelam Yadav