Diabetes mellitus (DM) refers to a group of metabolic disorders with defective insulin secretion, insulin action or both. Insulin promoter factor-1 (IPF-1) gene plays a central role in the development of the pancreas and regulation of insulin gene expression in β cells. This study aimed to determine the frequencies of C18R,D76N, and R197H mutations in the coding region of the IPF-1gene in a cohort of Sudanese patients with type 2 DM. Following informed consent, 96 individuals in eleven families with one or more diabetic members.DNA was extracted from EDTA-venous blood and buccal washes using the phenol-chloroform-iso-amyl alcohol (PCI) technique. Three variants (C18R, D76N, and R197H) were screened for by PCR-RFLP and the following primers:

[F: CATGAACGGCGAGGAGCAG][R: GCCATGTACAGGCACGCAG]

[F: TCCCGTACGAGGTGCCCCCCCTCGCCGTC] [R: CGGTTGGGCTCCTCCAGGAC]

[F: GGTGGAGCTGGCTGTCATGTTG] [R: AGGGCTGTGGCGACGCGTAAG] primers and:

[NlaIII, SalI and Fnu4HI] restriction enzymes for C18R, D76N and R197H mutations respectively.

A third (31/96, 32.3%) of the study individuals were diabetics with a mean age of 53±14.2years compared to 28±17.1years in non-diabetics. More than 95% of the diabetics were in the first and second generations. C18R gene mutation was detected in 3.2% of the diabetics and in 4.9% of non-diabetics. The D76N was seen in 3.1% of non-diabetic subjects only. The R197H gene variant was not detected in the study population. There was a strong correlation between maternal history of DM and the incidence of diabetes in the study families. C18R and D76Ngenes mutations play little part in the development of DM type 2 in Sudanese patients. Maternal family history correlates strongly to the development of type 2 DM.