Review Articles | Volume 12, Issue 6, November, 2024

Pharmacological and biotechnological overview of Sauropus androgynus L. Merr.: an underexploited perennial shrub

Dhaneswar Swain Bijaya Kumar Sahoo Ajaya Pattanaik Subrat Kumar Mahapatra Gyana Ranjan Rout   

Open Access   

Published:  Sep 16, 2024

DOI: 10.7324/JABB.2024.177942
Abstract

Sauropus androgynus L. Merr is an unexploited medicinal shrub under the family Phyllanthaceae known as a green multivitamin plant and used as a leafy vegetable. Many phytochemicals from the leaf extracts of S. androgynous act as antioxidant, anti-microbial, wound-healing, anti-inflammatory, anti-diabetic, and anti-obesity agents and can potentially enhance breast milk production. The leaf extracts of this shrub contain ascorbic acid, eugenol, gallic  acid, caffeic acid, syringic acid, p-coumaric acid, sinapic acid, ferulic acid, and different types of flavonoids. These phytochemicals have oxidative scavenging, glucosidase inhibitory, and superoxide dismutase activities. The plant has several nutrients to help metabolic activity and increase longevity. Herbal industries depend on natural resources. Identifying plant species is also essential before using them as herbal ingredients. DNA barcoding tags are used to determine the authenticity of plant species and herbal drugs. Seven barcoding markers have been tested for the identification of S. androgynus. Markers rbcl, rpoC1, and trnH-psbA showed the fragment size at 580, 500, and 520 bp, respectively. However, rpoC1I and adh reflect at 380 and 300 bp and the ycf5 show at 450 bp. These markers may be used to authenticate the plant and prepare herbal medicine. This review highlighted the basic biology, phytochemical, pharmacological, and biotechnological overview of S. androgynus for sustainable human health.


Keyword:     Sauropus androgynus Phytochemicals Multivitamin shrub DNA barcoding


Citation:

Swain D, Sahoo BK, Pattanaik A, Mahapatra SK, Rout GR. Pharmacological and biotechnological overview of Sauropus androgynus L. Merr.: an underexploited perennial shrub. J App Biol Biotech. 2024;12(6):21-28. http://doi.org/10.7324/JABB.2024.177942

Copyright: Author(s). This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike license.

HTML Full Text

1. INTRODUCTION

Sauropus androgynus L. Merr is a perennial shrub commonly known as Chekurmanis under the family Phyllanthaceae. It has various significant properties for the preparation of traditional medicines. It grows naturally in hot and humid climates, spreading over countries such as China, India, Sri Lanka, Vietnam, Indonesia, Malaysia, Papua New Guinea, Indonesia, Philippines, and Cambodia [1,2]. S. androgynus is a traditional herbal drug that alleviates fever [2,3] and cures vector-borne diseases [4]. The shrub is used for leafy vegetables in most of the tropical countries. Leaves are a galactagogue agent that stimulates lactate glands, enhancing and accelerating milk secretion in women [5]. Andarwulan et al. [6] reported that these shrubs have numerous medicinal values to cure diseases such as cholestasis, cough, ophthalmia, soreness, coryza, and erythrina. In addition, the stem and leaves of this shrub are used for treating hepatitis, laryngitis, and enteritis [7]. The root extract has been used to cure ailments such as dysentery, tuberculosis, and scabies [8]. Countries such as Taiwan and Malaysia have been used to control hypertension, gall bladder stones, hyperlipidemia, urolithiasis, and various gynecological disorders [9,10]. Padmavathi and Rao [1] noted that the shrub has also been named “multigreen” because of its high in vitamins A, B1, B2, and C, provitamin A, carbohydrate, protein, Ca, Zn, Fe, Cu, K, P, and α-tocopherol [11], and other bioactive compounds such as alkaloids, tannins, saponins, and flavonoids that are used as antibacterial agents as well as antioxidants [12]. Traditionally, this plant was more used by humans because its leaves were high in vitamin C and phenolic compounds [2]. It is reported that the vitamin content in the dry leaf deepened the age of the plant’s growth and development [13]. Mature leaf tissues have more vitamin and nutrient content than young leaves. The genetic diversity among the plants grown in different regions was analyzed using inter-simple sequence repeat (ISSR) markers [14]. The authenticity of the plant species using DNA barcoding tags helps to conserve the plants in nature. D’Souza et al. [15] used zinc oxide nanoparticles (ZnOSA NPs) derived from leaf extract of S. androgynus (SA) having sizes ranging from 12 to 23 nm for cancer therapy. They observed that ZnOSA NPs showed higher frequency anticancer properties against human triple-negative breast cancer cells. These nanoparticles have superior photocatalytic activity and high strength. Sagna et al. [16] reported that the hydroalcoholic leaf extract of S. androgynus exhibited ethnomedicinal activity and reduced the expression of the viral protein of the Chikungunya virus. Therefore, this review highlighted the biology, traditional ethnomedicinal knowledge, and biotechnological overview of the plant in human usefulness. It can help promote plant conservation and provide an opportunity to validate the medicinal use.


2. DESCRIPTION AND HIGHLIGHTS OF THE PLANT MORPHOLOGY AND ITS CHARACTERISTICS

Sauropus androgynus is known as “multigreen” due to its high vitamin and nutrient content, and this leafy vegetable is usually consumed raw in salad, stir-fried, used in curry, or cooked in soups in most countries in Southeast Asia. It grows abundantly in high-humidity locations. The branches are angular, and the leaves are pinnately compound. Flowers are dark red, and fruits are light yellow in color and globular in shape [17]. It has been reported that various communities in different countries use this shrub because of its nutritional and ethnomedicinal characteristics. S. androgynus is a valuable source of bioaccessibility of nutrients (Figure 1), food fortification, ethnomedicinal, and antioxidant characteristics. S. androgynus helps to increase lactation in women in Indonesia and Malaysia [10,18]. Furthermore, Thai people traditionally use the roots of this plant to reduce fever, treat food poisoning, and act as an antiseptic agent [19,20]. This plant has significant potential as a slimming agent to combat obesity. In India, the leaves are used as antidiabetic and to improve vision. Bhaskar et al. [21] reported that these shrubs have various antimicrobial properties, promote wound repair, and treat blurred vision and tonsillitis. It has also been reported as an antidiabetic aid [22]. The dark green leaves have various nutritional values and are used for human consumption in Southeast Asia. The leaves of S. androgynus are effective as an antioxidant [6,23]. Joshi et al. [24] identified 12 compounds abundantly distributed in S. androgynus leaves. The high percentage of the compounds is squalene (36.9%), vitamin E (12.5%), and linolenic acid (10.2%). The significant phytochemicals are camphor, borneol, 4-terpineol, 8-cymenol, α-terpineol, carvacrol methyl ether, carve one, sabinene hydrate acetate, thymol, α-terpinene acetate, carvacrol, butylated hydroxytoluene, cedrol, quercetin, kaempferol, and β-carotene [25]. It also acts as an antiviral and protective function on infected organs [25]. Linoleic acid treatment directly interacts with the white spot syndrome virus and inhibits the virus from entering cells and viral replication in the shrimp’s intestine [26,27]. Kaempferol showed significant inhibition against the Japanese encephalitis virus [28]. It contains many substances, such as sterols, resins, tannins, saponins, alkaloids, flavonoids, terpenoids, glycosides, and phenols [Tables 1A and 1B].

Figure 1: Salient features of S. androgynus L. Merr.



[Click here to view]

Table 1A: Phytochemical constituents in methanolic extract of S. androgynus stem.

Name of the Major Compounds PresentPercent PresentReferences
9, 12, 15-octadecatrienoic acid, ethyl ester (Z, Z, Z)14.48%Fikri et al. [29]
Phytol13.08%
Glycerin2.52%
1-Methyl-2-pyrrolidineethanol2.27%
Acetic acid1.81%
Pent-1-en-3-one,1-(2-furyl)-5-dimeth-ylamino1.69%
Benzofuran, 2,3-dihydro1.65%
2-Acetylpyrrolidine1.51%
4-O-methylmannose1.46%
N-Ethyl-2-carbomethoxyazetidine1.43%
9-Ethoxy-10-oxatricyclo [7.2.1.0 (1, 6)] dodecan-11-one1.36%
1H-indole, 5-fluoro-1.30%
Hexadecanoic acid1.18%
Oleic acid1.18%
Heptaethylene glycol monododecyl ether1.12%
N, N-dimethyl-2-aminoethanol1.05%
2-Methoxy-4-vinylphenol0.97%
L-Phenylalanine0.95%
Pentaethylene glycol0.95%
4, 6-Di-O-methyl-α-D-galactose0.94%
Octadecanoic acid0.85%
Thiophene, tetrahydro-2-methyl0.82%
3-Hexanol, 2, 5-dimethyl0.79%
Phenol0.76%
Tetradecanoic acid0.75%
Benzophenone, 3-methoxy-4’-methyl0.75%
Ethylidenecycloheptane0.75%
β-Sitosterol0.68%
9, 12-Octadecadienoic acid, methyl ester (E, E)0.63%
2-Pyrrolidinone0.50%
Morpholine0.48%
N-Chloroacetyl-D-phenylalanine0.47%
1-Butanol, 2-ethyl0.44%
4, 6-Di-O-methyl-α-D-galactose0.40%

Table 1B: Phytochemical constituents present in leaf extract of S. androgynus.

Name of the Major Compound PresentPercent Present*Percent Present**References
(9E,12E,15E)-Octadeca9,12,15-trienal36.98%Sawasdee et al. [14]
γ-Sitosterol0.98%0.54%
Squalene9.66%36.9%
Palmitic acid3.88%4.77%Sawasdee et al. [14]
δ-Tocopherol15.26%
8.9%Joshi et al. [24]
Phytol acetate2.84%Sawasdee et al. [14]
γ-Tocopherol1.73%5.80%
7.6%Joshi et al. [24]
β-Tocopherol1.86%Sawasdee et al. [14]
2.2%Joshi et al. [24]
Lanosta-8,24-dien-3-ol4.01%Sawasdee et al. [14]
Lupenone4.96%
Hexadecanoic acid, ethyl ester4.00%
Hexadecanoic acid5.6%Joshi et al. [24]
3,7,11,15-Tetramethyl-2-hexadecen-1-ol0.69%Sawasdee et al. [14]
dl-α-Tocopherol1.89%
Lupeol acetate1.03%
Caryophyllene1.00%
Tetradecanoic acid0.24%
Tetradecanoic acid, ethyl ester0.83%
Hexadecanoic acid, methyl ester0.48%
Ethyl 4-ethoxybenzoate0.44%
1,1’-Methylene-bis(di-2-propenylamine)0.20%
β-Caryophyllene0.1%Joshi et al. [24]
Methyl hexadecanoate0.5%
Linolenic acid10.2%
Vit E12.5%
Phytonadione0.7%
Sesquiterpene hydrocarbon0.1%
Long-chain oxygenated hydrocarbons16.3%
Triterpenoids42.8%
Chromane terpenoids31.2%
Quinine terpenoid0.7%
(E)-β-IononeT
Phenyl derivativeT
β-Sitosterol5.9%
Neophytadiene2.92%Anju et al. [17]

Selvi and Bhaskar [30]

Palmitic acid48.73%Anju et al. [17]
Santoso and Fenita [31]
Myristic acid8.81%
Stearic acid3.08%
Oleic acid6.72%
Decanoic acid0.57%Anju et al. [17]

Selvi and Bhaskar [30]

Phytol13.08%Anju et al. [17]

Fikri et al. [29]

Squalene8.06%Anju et al. [17]

Selvi and Bhaskar [30]

Solanesol4.09%Anju et al. [17]

Kuttinath et al. [32]

Terpenoids4.03%Anju et al. [17]
Awaludin et al. [33]
Linoleic acid5.25%
Phenolic compounds15.3%
Carotenoid32%

*Ethanol solvent used. **Hexane solvent used.


3. IN VITRO CLONAL PROPAGATION OF S. ANDROGYNUS

Generally, S. androgynus is propagated by either seed or stem cuttings. However, seed propagation is relatively low. Quality planting materials are necessary for propagation. The authenticity of planting material is of utmost importance when preparing plant products. Eganathan and Parida [34] established the in vitro protocol for large-scale propagation of S. androgynus using nodal culture. The nodes were inoculated on Murashige and Skoog’s (MS) [35] medium along with different concentrations of 6-benzylaminopurine (BAP; 0.1–2.5 mg/l) and kinetin (0.01–0.25 mg/l). After 4 weeks of culture, the shoot proliferation was achieved on MS medium supplemented with 1.0 mg/l BAP and 0.1 mg/l kinetin. Root initiation from the excised in vitro shoots on ½ strength MS medium fortified with 0.5 mg/l indole-3-butyric acid and 0.25 mg/L α-napthaleneacetic acid. Wee et al. [36] reported the plant regeneration pathway of S. androgynus through an in vitro culture system. Plant tissue culture is an alternative step of propagation to overcome the limitations of conventional multiplication and ensure the sustainable production of quality plant material with desirable traits. They successfully grew shoots through liquid culture and achieved more advantages over semisolid growth mediums. Acclimatization and survival growth rates were higher in the natural environment.


4. MOLECULAR STUDY OF S. ANDROGYNUS

Widely cultivated S. androgynus is used for various traditional medicinal purposes. There are 27 Sauropus species used as vegetables and in conventional medicine [37]. All plant parts have different active properties such as nutritional, vitamins, antioxidant, antimicrobial, antiviral, and so on. Over 100 active metabolites were developed from leaves, shoots, and roots. Antiobesity properties were observed in the leaf extract of S. androgynus, which helps to reduce body weight. The selection of S. androgynus is based on phenotypical, biochemical, and phytochemical properties. However, these approaches are not specific to the authenticity of the plant species. Genetic variation occurs due to plants’ adaptation to their environment and the passing of their genes onto subsequent generations. There are very close similarities in morphological points of view. Wide domestication resulted in botanical evolution and diversity, which caused significant changes in ITS sequences. Recently, DNA technology has been used to authenticate the plant species more accurately, which is a prerequisite for pharmaceutical and chemical investigation. PCR-based DNA technology has been used to identify plant species and herbal crude drugs [38-40]. Yunita et al. [41] reported the molecular study of intraspecific differences among S. androgynus (L.) Merr, which originated in Indonesia. They observed variability in the sequences of nuclear ribosomal DNA’s internal transcribed spacer (ITS) regions. Sawasdee et al. [42] used ISSR primers to identify the genetic similarity between the Sauropus species and the close relative genus Breynia species. Based on the similarity index, the variation of similarity value was 0.71–0.81 between Breynia and Sauropus, 0.76–0.85 at the interspecific level of Breynia, and 0.69–0.80 in the Sauropus species. They also reported that the barcodes rpoB and trnH-psbA spacer regions help to identify the genus at the species level. Amplification of the DNA fragments in the rpoB and psbA-trnH spacer regions of the Breynia and Sauropus species showed sizes of 500 and 400 bp, respectively. With sequence alignments of the MEGA7, genetic distances of the two genera revealed that the distances were 0.000–0.008 at the intergeneric level, 0.000–0.008 between the interspecific Sauropus species in the rpoB region, 0.000–0.099 at the intergeneric level, and 0.000–0.120 between the interspecific Sauropus species in the psbA-trnH spacer region [42]. Rout and Swain (unpublished data) [43] used seven barcoding markers (rbcL, rpoc1,psbA-trnH, rpoc1, ycf5, adh, and matK) to distinguish and recognize the economic species to help in the conservation of natural resources [44]. Moreover, rbcL and matK are the most valuable genes for identifying genus and species levels [45]. Nowadays, methods for studying the identification of plants rely on nuclear and chloroplast genome sequencing because of the simple and stable genetic structure of the chloroplast and nuclear genome. The universal primers, such as rbcL, matK, and rpoC1, amplify these target sequences [Figure 2]. DNA fragment amplification in the rbcL,rpoC1, psbA-trnH, rpoC1, ycfs, adh, and matK spacer regions of the S. androgynus showed sizes of approximately 580, 500, 520, 380, 300, 450, and 560, respectively [Table 2]. The protein signature of S. androgynus is also illustrated in Figure 2. SDS-PAGE analysis indicates that seven leaf protein fragments emerge in S. androgynus ranging from 20.1 to 81.7 kDa.

Figure 2: Protein and DNA profile of S. androgynus [43].



[Click here to view]

Table 2: DNA barcoding analysis of S. androgynus [43].

Barcoding Primers UsedSequence (5’–3’)Annealing Temperature (°C)Fragment Size (bp)
rbcLF:ATGTCACCACAAACAGAGACTAAAGC55580
R:GTAAAATCAAGTCCACCRCG
rpoC1F2:GGCAAAGAGGGAAGATTTCG55500
R4:CCATAAGCATATCTTGAGTTGG
psbA-trnHF:GTTATGCATGAACGTAATGCTC56520
R:CGCGCATGGTGGATTCACAATCC
rpoC1F1:GTGGATACACTTCTTGATAATGG55380
R3:TGAGAAAACATAAGTAAACGGGC
ycf5F1:GGATTATTAGTCACTCGTTGG55300
R4:CCCAATACCATCATACTTAC
adhF:CACACCGACGTCTACTTCTG52560
R:AGAGTGTTGGAGAGGGTGTGAC
matKF:ATGCAACACCCTGTTCTGAC52480
R:TAATTAAGAGGATTCACCAG

5. NUTRIENT AND PHYTOCHEMICAL CONSTITUENTS

Sauropus androgynus is multigreen vegetables with high nutrient and vitamin content [46]. Padmavathi and Rao [1] reported that leaves contain about 7.4 g of protein per 100 g of fresh leaves as compared with other leafy vegetables (2.0 g in spinach, 4.8 g in mint, and about 1.8 g in cabbage) [47]. Apart from the protein, the plants contain different minerals and vitamins. Notably, 100 g of fresh leaves contain 5.25–7.4 g proteins, 0.58–1.1 g fat, 1.75–1.8 g fiber, 69.9–85.4 g moisture, 5600 μg carotene, 0.21 mg riboflavin, 0.50 mg thiamine, 244–314.3 mg vitamin C, 45.7 mg potassium, 1.62 mg cobalt, 25.6 mg manganese, 768.7 mg copper, 306.3 mg sodium, 15.9 mg zinc, 212.5 mg iron, 664.9 mg magnesium, 84.4–711 mg calcium, 543 mg phosphorus, and 8.8 mg iron [1,46]. Wang and Lee [48] identified nucleosides, flavonoldiosides, and trioside from leaf extracts of S. androgynus. Singh et al. [46] identified phytochemicals such as polyphenols, anthocyanins, carotenoids, vitamins, and tannins. Selvi and Baskar [30] noted that leaves of S. androgynus contain different compounds such as sterols, terpenoids, glycosides, resins, tannins, saponins, alkaloids, flavonoids, phenols, catechol, cardiac glycosides, and acidic compounds [49]. Yu et al. [50] isolated and identified a novel compound, i.e., 3-O-β-D-glucosyl-(1-6)-β-D-glucosyl-kaempferol, having antiobesity properties. The leaves also recorded high content of flavonoids and organic compounds with antimicrobial, anti-inflammatory, antioxidant, and anticancer properties [6,30]. Sai and Srividya [22] evaluated the aqueous leaf extract of S. androgynus on the postprandial glucose levels in human blood. They observed that patients’ glycemic index was significantly lower than the control group. S. androgynus has a high potential for lowering glucose levels in human blood and helping to reduce diabetes. Over an extended period, more consumption of young leaves resulted in a high weight loss reduction. They have concluded that 3-O-β-D-glucosyl-(1-6)-β-D-glucosyl-kaempferol can be an antiobesity agent. Bhaskar et al. [21] studied wound healing using the water extract of S. androgynus with a rat model system. They found that smaller macrophages, fibroblasts, and potential ability as a wound-healing agent repaired wound tissue. Purba and Paengkoum [51] identified the phytochemicals (ascorbic acid, eugenol, gallic acid, caffeic acid, syringic acid, p-coumaric acid, sinapic acid, ferulic acid, catechin, myricetin, quercetin, apigenin, and kaempferol) associated with S. androgynus plant and used for various diseases. Kanchanapoom et al. [52] reported the major active compound, “Sauroposide,” based on spectral analysis from the aerial part of the plant. Furthermore, Wei et al. [53] identified several organic compounds isolated from the stem extract of S. androgynus, which have carboxylic, phenolic, and amino groups. The activity of these phytochemicals is not deepened in the environment. The leaf extract of SA has therapeutic potential [54] and wound-healing properties [55]. Asokawati et al. [56] reported a significant effect on breast milk production and increasing baby weight in the independent practice of maiden district midwives using leaf extract [57].


6. PHARMACOLOGICAL STUDIES

Pharmacological studies are also crucial to studying the toxicity or potential side effects of any extract used by human beings to treat their diseases. Several reports indicate that the herb has multiple bioactive compounds for various therapeutic values. It has been reported that the aqueous leaf extract of S. androgynus helps in the reduction of human blood glucose levels [37]. Long-term consumption of young leaves helps lose body weight and is an antiobesity activity. Bhaskar et al. [21] reported that water extract at a low concentration (5%) helps in wound healing activity. Based on a histological study of male and female rats, they observed smaller macrophages, fibroblasts, and rich collegenation. The ethanolic leaf extract showed high anti-inflammatory activity as reported by Selvi and Bhaskar [58]. Soka et al. [10] noted that the leaf extract of S. androgynus helps to induce breast milk production. They observed that the oxytocin and prolactin gene expression increased significantly after consuming the leaf extract tested in mice. The leaf extract helps in the early circulation of oxytocin hormone in the bloodstream. Xin et al. [59] studied the cytotoxicity and genotoxicity in CHL-1 human cell lines using different concentrations of fresh and cooked leaf extract of S. androgynus. They observed that no changes took place in the chromosomes. It was further reported that the ethanolic extract inhibits cell growth [60]. Subsequently, Yunita et al. [61] evaluated the methanolic leave extract of S. androgynus against human mesenchymal stem cells originating from bone marrow. They found that the extract is less cytotoxic to the stem cell with IC50 2450 mg/l. Bunawan et al. [47] reported that the S. androgynus herb has potential outbreaks of pulmonary dysfunction. More amount of consumption leads to respiratory failure. Joshi et al. [24] studied the lipophilic fraction of the leaves of S. androgynus against viruses using the Vero CCL-81 cell line. They reported that the leaf fraction has potential antiviral activity against dengue, but not chikungunya. Furthermore, the fraction was studied against P. falciparum strain 3D7 culture in O+ human erythrocytes and reported no positive effect against malaria parasites. Based on in silico analysis, they also noted that β-sitosterol has a strong interaction with the dengue virus E glycoprotein, which inhibits the fusion process.


7. ANTIOXIDANT AND ANTIMICROBIAL ACTIVITY

The nutritional composition of S. androgynus varied during different plant growth and development [62]. It has several significant benefits, called multivitamins, and helps with neurological disorders and weight gain [63,64]. The combination of leaf extract of S. androgynus and Moringa oleifera showed a substantial effect on antioxidant activity [65]. The leaf extract of S. androgynus has high flavonoids and vigorous antioxidant activity as reported [21,66]. The study also implies that the plant has free radical scavenging, polyphenol content, cupric ion chelating activities, inhibiting the ferric ion antioxidant properties, and lipid peroxidation [67]. The methanolic and ethanolic extracts have a significant effect on antibacterial activity against Proteus vulgaris, Bacillus cereus, Klebsiella pneumonia, Staphylococcus aureus, Bacillus subtilis, Escherichia coli, and Salmonella typhimurium [68-70]. Selvi et al. [71] reported that plant extract also has antifungal effects against Aspergillus flavus and Candida albicans. Fikri et al. [29] observed that leaf extracts prevent infectious diseases, aging, and degenerative diseases due to high vitamin C, polyphenols, and flavonoid compounds. The section shows the high competence of flavonoids, holds back the release of lysosomal content from polyphenolic neutrophils, and donates convincing as an anti-inflammatory activity. Some phytoconstituents such as saponins, tannins, triterpenoids, and coumarin are linked with non-steroidal anti-inflammatory drugs, antinociceptive, and analgesic. Methanolic leaf extract S. androgynus is significantly used as multivitamins and peptides, glycosides, alkaloids, saponins, terpenoids, and flavonoids [72]. It is traditionally used to increase the hormone prolactin and oxytocin levels to stimulate lactation. Vitamin A is sourced from carotenoids from S. androgynus extract and synthesizes retinol, which reacts with fatty acids to release the hormone prolactin. The hormone prolactin stimulates the development of secretory glands in the intralobular duct. Increased activity of secretary glands with lipids and unilocular fat tissue can prepare mammary glands before letting down milk. Dewajee et al. [73] detected the phytochemicals responsible for the anthelmintic activity, i.e., alkaloids, phytosterols, tannins, flavonoids, saponins, and so on.


8. CONCLUSION

The research analysis highlighted the efficacy of S. androgynus, which is an unexploited shrub used for traditional herbal medicine, breast milk inducer, wound healing, and antimicrobial and antioxidant activity. The shrub has more active metabolites such as alkaloids, flavonoids, phenols, terpenoids, glycosides, nutrients, protein, fat, carbohydrates, organic compounds, and vitamins for curing various diseases and treatments. Many researchers have evaluated S. androgynus plants’ efficacy in making pharmaceutical preparations as patent drugs for therapy. The S. androgynus leaves a potential source of phytochemical compounds with health-promoting properties for introspective production. The phytochemical profile variation depends on solvent type, but not on the plant’s cultivation location or the sampling time. The authenticity of plant species is also of utmost importance to derived phytochemicals. DNA bar-cording study can identify the authenticating source of the plant. For authenticity, Rout and Swain (unpublished data) [43] used eight barcoding markers to identify the plant species. These barcoding markers are treated as DNA-based molecular markers for future identification. There will be no chance to mix with other herbal drugs. This research analysis provides the biology, phytochemical, and biotechnological overview of S. androgynus, which is a multivitamin shrub for human welfare. Further research is necessary to utilize these active compounds to prepare nano-herbal drugs for higher efficiency and usefulness.


9. ACKNOWLEDGMENTS

The authors wish to acknowledge the President, Siksha “o” Anusandhan Deemed to be university, Bhubaneswar for providing the laboratory facilities for the molecular study.


10. AUTHOR CONTRIBUTIONS

DS and GRR: Literature review and lab experiment. SKM: Research methodology design, statistical analysis, and graphics. BKS and AKP: Plant collection and literature search. GRR: Manuscript writing and editing. All authors approved the manuscript.


11. FINANCIAL SUPPORT AND SPONSORSHIP

Financial support from SOADU, Bhubaneswar.


12. CONFLICT OF INTEREST

The authors report no financial or any other conflicts of interest in this work.


13. ETHICAL APPROVALS

This study does not involve experiments on animals or human subjects.


14. DATA AVAILABILITY

All the data is available with the authors and shall be provided upon request.


15. USE OF ARTIFICIAL INTELLIGENCE (AI)-ASSISTED TECHNOLOGY

The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.


16. PUBLISHER’S NOTE

All claims expressed in this article are solely those of the authors and do not necessarily represent those of the publisher, the editors and the reviewers. This journal remains neutral with regard to jurisdictional claims in published institutional affiliation.


REFERENCES

1.  Padmavathi P, Rao MP. Nutritive value of Sauropus androgynus leaves. Plant Foods Hum Nutr. 1990;40:107–13.

2.  Zhang BD, Cheng JX, Zhang CF, Bai YD, Liu WY, Li W, et al. Sauropus androgynus L. Merr.-A phytochemical, pharmacological and toxicological review. J Ethnopharmacol. 2020;257:112778.

3.  Khare CP. Indian medicinal plants: an illustrated dictionary. New York (NY): Springer; 2007.

4.  World Health Organization. Vector-borne diseases. World Health Organization; 2020.

5.  World Health Organization. Regional office for South-East Asia traditional medicine in Asia. WHO Regional Office for South-East Asia; 2002.

6.  Andarwulan N, Batari R, Sandrasari DA, Bolling B, Wijaya H. Flavonoid content and antioxidant activity of vegetables from Indonesia. Food Chem. 2010;121:1231–5.

7.  Ekasari W, Fatmawati D, Khoiriah SM, Baqiuddin WA, Nisa HQ, Maharupini AAS, et al. Antimalarial activity of extract and fractions of Sauropus androgynus (L.) Merr. Hindawi Sci. 2022;3552491. [CrossRef]

8.  Lai XZ, Yang YB, Shan XL. The investigation of euphorbiaceous medicinal plants in southern China. Econ Bot. 2004;58:S307–20.

9.  Ger LP, Chiang AA, Lai RS, Chen SM, Tseng CJ. Association of Sauropus androgynus and bronchiolitis obliterans syndrome: a hospital-based case-control study. Am J Epidemiol. 1997;145:842–9.

10.  Soka S, Alam H, Boenjamin N, Agustina TW, Suhartono MT. Effect of Sauropus androgynus leaf extracts on the expression of prolactin and oxytocin genes in lactating BALB/C mice. J Nutrigenet Nutrigen. 2010;3:31–6.

11.  Ching LS, Mohamed S. Alpha-tocopherol content in 62 edible tropical plants. J Agric Food Chem. 2001;49:3101–5.

12.  Bose R, Kumar MS, Manivel A, Mohan SC. Chemical constituents of Sauropus androgynus and evaluation of its antioxidant activity. Res J Phytochem. 2018;12:7–13.

13.  Lee SK, Kader AA. Preharvest and postharvest factors influencing vitamin C content of horticultural crops. Postharvest Biol Technol. 2000;20:207–20.

14.  Sawasdee N, Chaveerach A, Tanee T, Suwannakud KS, Ponkham P, Sudmoon R. Sauropus species containing eudesmin and their DNA profile. Asian J Agric Biol. 2019;7:412–22.

15.  D’Souza JN, Nagaraja GK, Prabhu A, Navada KM, Kouser S, Manasa DJ. Sauropus androgynus (L.) leaf phytochemical activated biocompatible zinc oxide nanoparticles: an antineoplastic agent against human triple negative breast cancer and a potent nanocatalyst for dye degradation. Appl Surface Sci. 2021;552:149429.

16. Sagna A, Nair VR, Hulyalkar N, Rajasekharan S, Vinodkumar Nair TG, Sivakumar KC, et al. Ethyl palmitate, an anti-chikungunya virus principle from Sauropus androgynus, a medicinal plant used to alleviate fever in ethnomedicine. J Ethnopharmacol. 2023;309:116366.

17.  Anju T, Kumari N, Rai SR, Kumar A. Sauropus androgynus (L.) Merr.: a multipurpose plant with multipleuses in traditional ethnic culinary and ethnomedicinal preparations. J Ethnic Foods. 2022;9:10–39.

18.  Andarwulan N, Kurniasih D, Apriady RA, Rahmat H, Roto AV, Bolling BW. Polyphenols, carotenoids, and ascorbic acid in underutilized medicinal vegetables. J Funct Foods. 2012;4:339–47.

19.  Benjapak N, Swatsitang P, Tanpanich S. Determination of antioxidant capacity and nutritive values of Pak-Wanban (Sauropus androgynus L. Merr.). Khon-Kean Univ Sci J. 2008;36:279–89.

20.  Bender AE, Ismail KS. Nutritive value and toxicity of Sauropus androgynous. Proc Nutr Soc. 1973;32:79–80A.

21.  Bhaskar A, Ramesh KV, Rajeshwari. Wound healing profile of Sauropus androgynus in Wistar rats. J Nat Remed. 2009;9:159–64.

22.  Sai KS, Srividya N. Blood glucose lowering effect of the leaves of Tinospora cordifolia and Sauropus androgynus in diabetic subjects. J Nat Remed. 2002;2:28–32.

23.  Rahmat A, Kumar V, Fong LM, Endrini S, Sani HA. Determination of total antioxidant activity in three types of local vegetable shoots and the cytotoxic effect of their ethanolic extracts against different cancer cell lines. Asia Pac J Clin Nutr. 2003;12:292–5.

24.  Joshi RK, Agarwal S, Patil P, Alagarasu K, Panda K, Prashar C, et al. Effect of Sauropus androgynus L. Merr. on dengue virus-2: an in vitro and in silico study. J Ethnopharmacol. 2023;304:116044. [CrossRef]

25.  Li C, Yang MC, Hong PP, Zhao XF, Wang JX. Metabolomic profiles in the intestine of shrimp infected by white spot syndrome virus and antiviral function of the metabolite linoleic acid in shrimp. J Immunol. 2021;206:2075–87.

26.  Teafatiller T, Agrawal S, De Robles G, Rahmatpanah F, Subramanian VS, Agrawal A. Vitamin C enhances antiviral functions of lung epithelial cells. Biomolecules. 2021;11:1148.

27.  Raini SK, Takamatsu Y, Dumre SP, Urata S, Mizukami S, Moi ML, et al. The novel therapeutic target and inhibitory effects of PF-429242 against Zika virus infection. Antivir Res. 2021;192:105121.

28.  Care C, Sornjai W, Jaratsittisin J, Hitakarun A, Wikan N, Triwitayakorn K, et al. Discordant activity of kaempferol towards dengue virus and Japanese encephalitis virus. Molecules. 2020;25:1246.

29.  Fikri F, Thohawi M, Purnama E. Pharmacology and phytochemistry overview on Sauropus androgynous. Sys Rev Pharm. 2020;11:124–8.

30.  Senthamarai Selvi V, Baskar A. Evaluation of bioactive components and antioxidant activity of Sauropus androgynus plant extracts using GC-MS analysis. Int J Pharma Sci Rev Res. 2012;12:65–7.

31.  Santoso U, Fenita Y. The effect of Sauropus androgynus leaf extract on performance, egg quality and chemical composition of eggs. J Indones Trop Anim Agric. 2016;41:125–34.

32.  Kuttinath S, Kh H, Rammohan R. Phytochemical screening, antioxidant, antimicrobial, and antibiofilm activity of Sauropus androgynus leaf extracts. Asian J Pharm Clin Res. 2019;12:224–50.

33.  Awaludin A, Kartina K, Maulianawati D, Manalu W, Andriyanto A, Septiana R, et al. Phytochemical screening and toxicity of ethanol extract of Sauropus androgynus. Biodiversitas J Biol Divers. 2020;21:2966–70.

34.  Eganathan P, Parida A. Micropropagation of Sauropus androgynus (L.) Merr.—an important green leafy vegetable. Ind J Biotech. 2012;11:235–7.

35.  Murashige T, Skoog F. A revised medium for rapid growth and bio-assays with tobacco tissue cultures. Physiol Plant. 1962,15:473–97.

36.  Wee SL, Alderson PG, Yap WSP. In vitro propagation of Sauropus androgynous (Sweet shoot): the potential of different regeneration pathways. Acta Hortic. 2013;979:509–15.

37.  Welzen PCV, Chayamarit K. Euphorbiaceae-Flora of Thailand. Fl, Thailand. 2007;8:521–54.

38.  Alvarez I, Wendel JF. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 2003;29:417–34.

39.  Yip PY, Chau CF, Mak CY, Kwan HS. DNA methods for identification of Chinese medicinal materials. Chin Med. 2007;2:9.

40.  Joshi K, Chavan P, Warude D, Patwardhan B. Molecular markers in herbal drug technology. Curr Sci. 2004;87:159–65.

41.  Yunita O, Rochmawati ID, Fadhilah NA, Benarkah N. Molecular study of intraspecific differences among Sauropus androgynus(L.) Merr. From Indonesia revealed by ITS region variability. Biotechnol Biotechnol Equip. 2016;30:1212–6.

42.  Sawasdee N, Chaveerach A, Tanee T, Suwannakud KS, Ponkham P, Sudmoon R. Sauropus species containing eudesmin and their DNA profile. Asian J Agric Biol. 2019;7:412–22.

43.  Rout GR, Swain D. DNA barcoding and SDS-PAGE analysis of Sauropus androgynus [Unpublished data].

44.  Kesanakurti PR, Fazekas AJ, Burgess KS, Percy DM, Newmaster SG, Graham SW, et al. Spatial patterns of plant diversity below-ground as revealed by DNA barcoding. Mol Ecol. 2011;20:1289–302.

45.  Dong W, Liu J, Yu J, Wang L, Zhou S. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and or DNA barcoding. PLoS One. 2012;7:e35071.

46.  Singh S, Singh DR, Singh KM, Srivastava A, Singh LB, Srivastava RC. Estimation of proximate composition, micronutrients and phytochemical compounds in traditional vegetables from Andaman and Nicobar Islands. Int J Food Sci Nutr. 2011;62:765–73.

47.  Bunawan H, Bunawan SN, Baharum SN, Noor NM. Sauropus androgynus (L.) Merr. induced Bronchiolitis Obliterans: from botanical studies to toxicology. Evid Based Complement Alternat Med. 2015;714158. [CrossRef]

48.  Wang PH, Lee SS. Active chemical constituents from Sauropus androgynus. J Chin Chem Soc. 1997;44:145-9.

49.  Gireesh A, Harsha H, Pramod H, Kholkute SD. Pharmacognostic and preliminary phytochemical analysis of Sauropus androgynus (L) Merr. Leaf. Int J Drug Dev Res. 2013;5:321–5.

50.  Yu SF, Shun CT, Chen TM, Chen YH. 3-O-β- d-gucosyl-(1 → 6)-β-d-glucosyl-kaempferol isolated from Sauropus androgynus reduces body weight gain in Wistar rats. Biol Pharma Bull. 2006;29:2510–3.

51.  Purba RAP, Paengkoum P. Exploring the phytochemical profiles and antioxidant, antidiabetic, and antihemolytic properties of Sauropus androgynus dried leaf extracts for ruminant health and production. Molecules. 2022;27:8580.

52.  Kanchanapoom T, Chumsri P, Kasai R, Otsuka H, Yamasaki K. Lignan and megastigmane glycosides from Sauropus androgynus. Phytochem. 2003;63(8):985–8.

53.  Wei LS, Wendy WEE, Siong JYF, Syamsumir DF. Characterization of antimicrobial, antioxidant, anticancer properties and chemical composition of Sauropus androgynus stem extract. Acta Med Litu. 2011;8:12–6.

54.  Arif T, Raviraja Shetty G. Therapeutic potential and traditional uses of Sauropus androgynous: a review. J Pharmacognosy Phytochem. 2020;9(3):2131–7.

55.  Panggabean RT, Sudjarwo SA, Ma’ruf A, Widiyatno TV, Yudaniayanti IS, Kurnijasanti R, et al. Efficacy of Sauropus androgynous leaves extract gel on burn wound healing in Albino Rats. J Med Vet. 2023;6(3):107–15.

56.  Asokawati FD, Kristiarini JJ, Sari F. The effectiveness of giving katukl leaf extract on breast milk production and increasing baby weight in the independent practice of madiun district midwives. J Health. 2021;8(2):114–20.

57.  Rahmawaty S, Padmasari ZA. Review on Katuk (Sauropus androgynus (L.) Merr.) and Milk production of breastfeeding mothers in Indonesia. In: M. Setiyo et al., editors. Proceedings of the 4th Borobudur International Symposium on Science and Technology 2022 (BIS-STE 2022). Adv Eng Res. 2023;225. [CrossRef]

58.  Selvi A, Bhaskar S. Anti-infammatory and analgesic activities of the Sauropus androgynus (L) Merr. (Euphorbiaceae) Plant in experimental animal models. Der Pharm Lett. 2012;4:782–5.

59.  Xin L, Xi-kun X, Jun-ming H, Wen-gai Z, Jing-bing W. Cytotoxicity and genotoxicity of Sauropus androgynous. Chinese J Health Lab Technol. 2006;9:1050–3.

60.  Yu SF, Chen TM, Chen YH. Apoptosis and necrosis are involved in the toxicity of Sauropus androgynus in an in vitro study. J Formosan Med Assoc. 2007;106:537–47.

61.  Yunita O, Yuwono M, Rantam FA. In vitro cytotoxicity assay of Sauropus androgynus on human mesenchymal stem cells. Toxicol Environ Chem. 2013;95:679–86.

62.  Naveena E, Janavi G, Arumugam T, Anitha T. Estimation of nutritive composition of Sauropus androgynus (Multivitamin plant) at different growth stages and position of leaves. Int J Chem Stud. 2020, 8:443–7.

63.  Suresh S, Sunitha D, Souza H, Sushma BV, Anitha C. Exploring the benefits of Sauropus androgynus as a natural approach in managing post partum weight gain: a review article. Int J Curr Sci. 2024;14:53–62.

64.  Patil NB, Patil KB, Kshirsagar SS. Medicinal plant is new horizons in spinocerebellar ataxia. Asian J Pharma Res. 2020;10(1):29–30.

65.  Endrawati S, Artanti N, Hanafi M. Antioxidant activity and compounds identification of Sauropus androgynus (L.) Merr. and Moringa oleifera Lam leaves combination fermented with Kombucha Consortium. Res J Pharmacy Technol. 2022;15(11):5184–1.

66.  Badami S, Channabasavaraj KP. In vitro antioxidant activity of thirteen medicinal plants of India’s Western Ghats. Pharma Biol. 2007;45:392–6.

67.  Wong SP, Leong LP, William Koh JH. Antioxidant activities of aqueous extracts of selected plants. Food Chem. 2006;99:775–83.

68.  Gayathramma K, Pavani KV, Raji R. Chemical constituents and antimicrobial activities of certain plant parts of Sauropus androgynus L. Int J Pharma Bio Sci. 2012;3:561–6.

69.  Ariharan VN, Devi VNM, Prasad PN. Antibacterial activity of Sauropus androgynus leaf extracts against some pathogenic bacteria. Int J Chem Environ Pharma Res. 2013;6:134–7.

70.  Chudobova D, Dostalova S, Blazkova I, Michalek P, Ruttkay-Nedecky B, Sklenar M, et al. Effects of ampicillin, streptomycin, penicillin and tetracycline on metal resistant and non resistant Staphylococcus aureus. Int J Environ Res Public Health. 2014;11:3233–55.

71.  Selvi VS, Govindaraju G, Basker A. Antifungal activity and phytochemical analysis of Cympogon citratus, Sauropus androgynus and Spillanthesac mella plants. World J Fungal Plant Biol. 2011;2:6–10.

72.  Prakoso YA, Kurniasih K, Wijayanti AD, Kristianingrum YP. Treatment of experimentally induced diabetic wound infected with methicillin-resistant Staphylococcus aureus using Aloe vera, Apium graveolens, and Sauropus androgynus extracts in rats. Int J One Health. 2019;5:99–106.

73.  Dewajee S, Maiti A, Kundu M, Mandal SC. Evaluation of anthelmintic activity of crude extracts of Diospyros peregrina, Coccinia grandis and Schima wallichii. Dhaka Univ J Pharm Sci. 2007;6:121–3.

Reference

1. Padmavathi P, Rao MP. Nutritive value of Sauropus androgynus leaves. Plant Foods Hum Nutr. 1990;40:107-13. https://doi.org/10.1007/BF02193767

2. Zhang BD, Cheng JX, Zhang CF, Bai YD, Liu WY, Li W, et al. Sauropus androgynus L. Merr.-A phytochemical, pharmacological and toxicological review. J Ethnopharmacol. 2020;257:112778. https://doi.org/10.1016/j.jep.2020.112778

3. Khare CP. Indian medicinal plants: an illustrated dictionary. New York (NY): Springer; 2007. https://doi.org/10.1007/978-0-387-70638-2

4. World Health Organization. Vector-borne diseases. World Health Organization; 2020.

5. World Health Organization. Regional office for South-East Asia traditional medicine in Asia. WHO Regional Office for South-East Asia; 2002.

6. Andarwulan N, Batari R, Sandrasari DA, Bolling B, Wijaya H. Flavonoid content and antioxidant activity of vegetables from Indonesia. Food Chem. 2010;121:1231-5. https://doi.org/10.1016/j.foodchem.2010.01.033

7. Ekasari W, Fatmawati D, Khoiriah SM, Baqiuddin WA, Nisa HQ, Maharupini AAS, et al. Antimalarial activity of extract and fractions of Sauropus androgynus (L.) Merr. Hindawi Sci. 2022;3552491. https://doi.org/10.1155/2022/3552491

8. Lai XZ, Yang YB, Shan XL. The investigation of euphorbiaceous medicinal plants in southern China. Econ Bot. 2004;58:S307-20. https://doi.org/10.1663/0013-0001(2004)58[S307:TIOEMP]2.0.CO;2

9. Ger LP, Chiang AA, Lai RS, Chen SM, Tseng CJ. Association of Sauropus androgynus and bronchiolitis obliterans syndrome: a hospital-based case-control study. Am J Epidemiol. 1997;145:842-9. https://doi.org/10.1093/oxfordjournals.aje.a009178

10. Soka S, Alam H, Boenjamin N, Agustina TW, Suhartono MT. Effect of Sauropus androgynus leaf extracts on the expression of prolactin and oxytocin genes in lactating BALB/C mice. J Nutrigenet Nutrigen. 2010;3:31-6. https://doi.org/10.1159/000319710

11. Ching LS, Mohamed S. Alpha-tocopherol content in 62 edible tropical plants. J Agric Food Chem. 2001;49:3101-5. https://doi.org/10.1021/jf000891u

12. Bose R, Kumar MS, Manivel A, Mohan SC. Chemical constituents of Sauropus androgynus and evaluation of its antioxidant activity. Res J Phytochem. 2018;12:7-13. https://doi.org/10.3923/rjphyto.2018.7.13

13. Lee SK, Kader AA. Preharvest and postharvest factors influencing vitamin C content of horticultural crops. Postharvest Biol Technol. 2000;20:207-20. https://doi.org/10.1016/S0925-5214(00)00133-2

14. Sawasdee N, Chaveerach A, Tanee T, Suwannakud KS, Ponkham P, Sudmoon R. Sauropus species containing eudesmin and their DNA profile. Asian J Agric Biol. 2019;7:412-22.

15. D'Souza JN, Nagaraja GK, Prabhu A, Navada KM, Kouser S, Manasa DJ. Sauropus androgynus (L.) leaf phytochemical activated biocompatible zinc oxide nanoparticles: an antineoplastic agent against human triple negative breast cancer and a potent nanocatalyst for dye degradation. Appl Surface Sci. 2021;552:149429. https://doi.org/10.1016/j.apsusc.2021.149429

16. Sagna A, Nair VR, Hulyalkar N, Rajasekharan S, Vinodkumar Nair TG, Sivakumar KC, et al. Ethyl palmitate, an anti-chikungunya virus principle from Sauropus androgynus, a medicinal plant used to alleviate fever in ethnomedicine. J Ethnopharmacol. 2023;309:116366. https://doi.org/10.1016/j.jep.2023.116366

17. Anju T, Kumari N, Rai SR, Kumar A. Sauropus androgynus (L.) Merr.: a multipurpose plant with multipleuses in traditional ethnic culinary and ethnomedicinal preparations. J Ethnic Foods. 2022;9:10-39. https://doi.org/10.1186/s42779-022-00125-8

18. Andarwulan N, Kurniasih D, Apriady RA, Rahmat H, Roto AV, Bolling BW. Polyphenols, carotenoids, and ascorbic acid in underutilized medicinal vegetables. J Funct Foods. 2012;4:339-47. https://doi.org/10.1016/j.jff.2012.01.003

19. Benjapak N, Swatsitang P, Tanpanich S. Determination of antioxidant capacity and nutritive values of Pak-Wanban (Sauropus androgynus L. Merr.). Khon-Kean Univ Sci J. 2008;36:279-89.

20. Bender AE, Ismail KS. Nutritive value and toxicity of Sauropus androgynous. Proc Nutr Soc. 1973;32:79-80A.

21. Bhaskar A, Ramesh KV, Rajeshwari. Wound healing profile of Sauropus androgynus in Wistar rats. J Nat Remed. 2009;9:159-64.

22. Sai KS, Srividya N. Blood glucose lowering effect of the leaves of Tinospora cordifolia and Sauropus androgynus in diabetic subjects. J Nat Remed. 2002;2:28-32.

23. Rahmat A, Kumar V, Fong LM, Endrini S, Sani HA. Determination of total antioxidant activity in three types of local vegetable shoots and the cytotoxic effect of their ethanolic extracts against different cancer cell lines. Asia Pac J Clin Nutr. 2003;12:292-5.

24. Joshi RK, Agarwal S, Patil P, Alagarasu K, Panda K, Prashar C, et al. Effect of Sauropus androgynus L. Merr. on dengue virus-2: an in vitro and in silico study. J Ethnopharmacol. 2023;304:116044. https://doi.org/10.1016/j.jep.2022.116044

25. Li C, Yang MC, Hong PP, Zhao XF, Wang JX. Metabolomic profiles in the intestine of shrimp infected by white spot syndrome virus and antiviral function of the metabolite linoleic acid in shrimp. J Immunol. 2021;206:2075-87. https://doi.org/10.4049/jimmunol.2001318

26. Teafatiller T, Agrawal S, De Robles G, Rahmatpanah F, Subramanian VS, Agrawal A. Vitamin C enhances antiviral functions of lung epithelial cells. Biomolecules. 2021;11:1148. https://doi.org/10.3390/biom11081148

27. Raini SK, Takamatsu Y, Dumre SP, Urata S, Mizukami S, Moi ML, et al. The novel therapeutic target and inhibitory effects of PF-429242 against Zika virus infection. Antivir Res. 2021;192:105121. https://doi.org/10.1016/j.antiviral.2021.105121

28. Care C, Sornjai W, Jaratsittisin J, Hitakarun A, Wikan N, Triwitayakorn K, et al. Discordant activity of kaempferol towards dengue virus and Japanese encephalitis virus. Molecules. 2020;25:1246. https://doi.org/10.3390/molecules25051246

29. Fikri F, Thohawi M, Purnama E. Pharmacology and phytochemistry overview on Sauropus androgynous. Sys Rev Pharm. 2020;11:124-8. https://doi.org/10.31838/srp.2020.6.20

30. Senthamarai Selvi V, Baskar A. Evaluation of bioactive components and antioxidant activity of Sauropus androgynus plant extracts using GC-MS analysis. Int J Pharma Sci Rev Res. 2012;12:65-7.

31. Santoso U, Fenita Y. The effect of Sauropus androgynus leaf extract on performance, egg quality and chemical composition of eggs. J Indones Trop Anim Agric. 2016;41:125-34. https://doi.org/10.14710/jitaa.41.3.125-134

32. Kuttinath S, Kh H, Rammohan R. Phytochemical screening, antioxidant, antimicrobial, and antibiofilm activity of Sauropus androgynus leaf extracts. Asian J Pharm Clin Res. 2019;12:224-50. https://doi.org/10.22159/ajpcr.2019.v12i4.31756

33. Awaludin A, Kartina K, Maulianawati D, Manalu W, Andriyanto A, Septiana R, et al. Phytochemical screening and toxicity of ethanol extract of Sauropus androgynus. Biodiversitas J Biol Divers. 2020;21:2966-70. https://doi.org/10.13057/biodiv/d210712

34. Eganathan P, Parida A. Micropropagation of Sauropus androgynus (L.) Merr.-an important green leafy vegetable. Ind J Biotech. 2012;11:235-7.

35. Murashige T, Skoog F. A revised medium for rapid growth and bio-assays with tobacco tissue cultures. Physiol Plant. 1962,15:473-97. https://doi.org/10.1111/j.1399-3054.1962.tb08052.x

36. Wee SL, Alderson PG, Yap WSP. In vitro propagation of Sauropus androgynous (Sweet shoot): the potential of different regeneration pathways. Acta Hortic. 2013;979:509-15. https://doi.org/10.17660/ActaHortic.2013.979.55

37. Welzen PCV, Chayamarit K. Euphorbiaceae-Flora of Thailand. Fl, Thailand. 2007;8:521-54.

38. Alvarez I, Wendel JF. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 2003;29:417-34. https://doi.org/10.1016/S1055-7903(03)00208-2

39. Yip PY, Chau CF, Mak CY, Kwan HS. DNA methods for identification of Chinese medicinal materials. Chin Med. 2007;2:9. https://doi.org/10.1186/1749-8546-2-9

40. Joshi K, Chavan P, Warude D, Patwardhan B. Molecular markers in herbal drug technology. Curr Sci. 2004;87:159-65.

41. Yunita O, Rochmawati ID, Fadhilah NA, Benarkah N. Molecular study of intraspecific differences among Sauropus androgynus(L.) Merr. From Indonesia revealed by ITS region variability. Biotechnol Biotechnol Equip. 2016;30:1212-6. https://doi.org/10.1080/13102818.2016.1224978

42. Sawasdee N, Chaveerach A, Tanee T, Suwannakud KS, Ponkham P, Sudmoon R. Sauropus species containing eudesmin and their DNA profile. Asian J Agric Biol. 2019;7:412-22.

43. Rout GR, Swain D. DNA barcoding and SDS-PAGE analysis of Sauropus androgynus [Unpublished data].

44. Kesanakurti PR, Fazekas AJ, Burgess KS, Percy DM, Newmaster SG, Graham SW, et al. Spatial patterns of plant diversity below-ground as revealed by DNA barcoding. Mol Ecol. 2011;20:1289-302. https://doi.org/10.1111/j.1365-294X.2010.04989.x

45. Dong W, Liu J, Yu J, Wang L, Zhou S. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and or DNA barcoding. PLoS One. 2012;7:e35071. https://doi.org/10.1371/journal.pone.0035071

46. Singh S, Singh DR, Singh KM, Srivastava A, Singh LB, Srivastava RC. Estimation of proximate composition, micronutrients and phytochemical compounds in traditional vegetables from Andaman and Nicobar Islands. Int J Food Sci Nutr. 2011;62:765-73. https://doi.org/10.3109/09637486.2011.585961

47. Bunawan H, Bunawan SN, Baharum SN, Noor NM. Sauropus androgynus (L.) Merr. induced Bronchiolitis Obliterans: from botanical studies to toxicology. Evid Based Complement Alternat Med. 2015;714158. https://doi.org/10.1155/2015/714158

48. Wang PH, Lee SS. Active chemical constituents from Sauropus androgynus. J Chin Chem Soc. 1997;44:145-9. https://doi.org/10.1002/jccs.199700024

49. Gireesh A, Harsha H, Pramod H, Kholkute SD. Pharmacognostic and preliminary phytochemical analysis of Sauropus androgynus (L) Merr. Leaf. Int J Drug Dev Res. 2013;5:321-5.

50. Yu SF, Shun CT, Chen TM, Chen YH. 3-O-β- d-gucosyl-(1 → 6)-β-d-glucosyl-kaempferol isolated from Sauropus androgynus reduces body weight gain in Wistar rats. Biol Pharma Bull. 2006;29:2510-3. https://doi.org/10.1248/bpb.29.2510

51. Purba RAP, Paengkoum P. Exploring the phytochemical profiles and antioxidant, antidiabetic, and antihemolytic properties of Sauropus androgynus dried leaf extracts for ruminant health and production. Molecules. 2022;27:8580. https://doi.org/10.3390/molecules27238580

52. Kanchanapoom T, Chumsri P, Kasai R, Otsuka H, Yamasaki K. Lignan and megastigmane glycosides from Sauropus androgynus. Phytochem. 2003;63(8):985-8. https://doi.org/10.1016/S0031-9422(03)00219-X

53. Wei LS, Wendy WEE, Siong JYF, Syamsumir DF. Characterization of antimicrobial, antioxidant, anticancer properties and chemical composition of Sauropus androgynus stem extract. Acta Med Litu. 2011;8:12-6. https://doi.org/10.6001/actamedica.v18i1.1808

54. Arif T, Raviraja Shetty G. Therapeutic potential and traditional uses of Sauropus androgynous: a review. J Pharmacognosy Phytochem. 2020;9(3):2131-7.

55. Panggabean RT, Sudjarwo SA, Ma'ruf A, Widiyatno TV, Yudaniayanti IS, Kurnijasanti R, et al. Efficacy of Sauropus androgynous leaves extract gel on burn wound healing in Albino Rats. J Med Vet. 2023;6(3):107-15. https://doi.org/10.20473/jmv.vol6.iss3.2023.107-115

56. Asokawati FD, Kristiarini JJ, Sari F. The effectiveness of giving katukl leaf extract on breast milk production and increasing baby weight in the independent practice of madiun district midwives. J Health. 2021;8(2):114-20. https://doi.org/10.30590/joh.v8n2.114-120.2021

57. Rahmawaty S, Padmasari ZA. Review on Katuk (Sauropus androgynus (L.) Merr.) and Milk production of breastfeeding mothers in Indonesia. In: M. Setiyo et al., editors. Proceedings of the 4th Borobudur International Symposium on Science and Technology 2022 (BIS-STE 2022). Adv Eng Res. 2023;225. https://doi.org/10.2991/978-94-6463-284-2_76

58. Selvi A, Bhaskar S. Anti-infammatory and analgesic activities of the Sauropus androgynus (L) Merr. (Euphorbiaceae) Plant in experimental animal models. Der Pharm Lett. 2012;4:782-5.

59. Xin L, Xi-kun X, Jun-ming H, Wen-gai Z, Jing-bing W. Cytotoxicity and genotoxicity of Sauropus androgynous. Chinese J Health Lab Technol. 2006;9:1050-3.

60. Yu SF, Chen TM, Chen YH. Apoptosis and necrosis are involved in the toxicity of Sauropus androgynus in an in vitro study. J Formosan Med Assoc. 2007;106:537-47. https://doi.org/10.1016/S0929-6646(07)60004-7

61. Yunita O, Yuwono M, Rantam FA. In vitro cytotoxicity assay of Sauropus androgynus on human mesenchymal stem cells. Toxicol Environ Chem. 2013;95:679-86. https://doi.org/10.1080/02772248.2013.798412

62. Naveena E, Janavi G, Arumugam T, Anitha T. Estimation of nutritive composition of Sauropus androgynus (Multivitamin plant) at different growth stages and position of leaves. Int J Chem Stud. 2020, 8:443-7. https://doi.org/10.22271/chemi.2020.v8.i3e.9251

63. Suresh S, Sunitha D, Souza H, Sushma BV, Anitha C. Exploring the benefits of Sauropus androgynus as a natural approach in managing post partum weight gain: a review article. Int J Curr Sci. 2024;14:53-62.

64. Patil NB, Patil KB, Kshirsagar SS. Medicinal plant is new horizons in spinocerebellar ataxia. Asian J Pharma Res. 2020;10(1):29-30. https://doi.org/10.5958/2231-5691.2020.00006.4

65. Endrawati S, Artanti N, Hanafi M. Antioxidant activity and compounds identification of Sauropus androgynus (L.) Merr. and Moringa oleifera Lam leaves combination fermented with Kombucha Consortium. Res J Pharmacy Technol. 2022;15(11):5184-1. https://doi.org/10.52711/0974-360X.2022.00873

66. Badami S, Channabasavaraj KP. In vitro antioxidant activity of thirteen medicinal plants of India's Western Ghats. Pharma Biol. 2007;45:392-6. https://doi.org/10.1080/13880200701215141

67. Wong SP, Leong LP, William Koh JH. Antioxidant activities of aqueous extracts of selected plants. Food Chem. 2006;99:775-83. https://doi.org/10.1016/j.foodchem.2005.07.058

68. Gayathramma K, Pavani KV, Raji R. Chemical constituents and antimicrobial activities of certain plant parts of Sauropus androgynus L. Int J Pharma Bio Sci. 2012;3:561-6.

69. Ariharan VN, Devi VNM, Prasad PN. Antibacterial activity of Sauropus androgynus leaf extracts against some pathogenic bacteria. Int J Chem Environ Pharma Res. 2013;6:134-7.

70. Chudobova D, Dostalova S, Blazkova I, Michalek P, Ruttkay-Nedecky B, Sklenar M, et al. Effects of ampicillin, streptomycin, penicillin and tetracycline on metal resistant and non resistant Staphylococcus aureus. Int J Environ Res Public Health. 2014;11:3233-55. https://doi.org/10.3390/ijerph110303233

71. Selvi VS, Govindaraju G, Basker A. Antifungal activity and phytochemical analysis of Cympogon citratus, Sauropus androgynus and Spillanthesac mella plants. World J Fungal Plant Biol. 2011;2:6-10.

72. Prakoso YA, Kurniasih K, Wijayanti AD, Kristianingrum YP. Treatment of experimentally induced diabetic wound infected with methicillin-resistant Staphylococcus aureus using Aloe vera, Apium graveolens, and Sauropus androgynus extracts in rats. Int J One Health. 2019;5:99-106. https://doi.org/10.14202/IJOH.2019.99-106

73. Dewajee S, Maiti A, Kundu M, Mandal SC. Evaluation of anthelmintic activity of crude extracts of Diospyros peregrina, Coccinia grandis and Schima wallichii. Dhaka Univ J Pharm Sci. 2007;6:121-3. https://doi.org/10.3329/dujps.v6i2.687

Article Metrics
1035 Views 294 Downloads 1329 Total

Year

Month

Related Search

By author names