Research Article | Volume 12, Issue 2, March, 2024

Assessing the role of temperature as an elicitor for indole-3-acetic acid production in cyanobacterial species

Priyanka Behera Dhanesh Kumar Shubhashree Mahalik   

Open Access   

Published:  Feb 20, 2024

DOI: 10.7324/jabb.2024.160443
Abstract

Cyanobacteria are well known for tolerance toward high level of environmental stresses. They produce several bioactive molecules as a protective measure for survival and growth under abiotic stress. The present study investigates the effect of temperature on cyanobacteria’s ability to produce indole-3-acetic acid (IAA) with tryptophan as a precursor. Three cyanobacterial species, namely, Westiellopsis sp. TPR-29, Hapalosiphon sp. Ryu2-7DN_D3, and Chlorogloeopsis fritschii PCC 6912, were exposed to 15°C, 25°C, 35°C, and 45°C, and its effect on indole-3- acetic production capacity was tested. After 15 days incubation in above temperature, growth (as measured by cell density and chlorophyll A content); biochemical parameters such as carbohydrate, protein, lipids, and extracellular polysaccharide; and stress indicators such as malondialdehyde (MDA), catalase (CAT), and reactive oxygen species (ROS) were examined. Estimates were also made for the production of IAA. Exposure to higher temperature resulted in reduction of growth and macromolecular contents whereas ROS and MDA content increased significantly at 45°C with a concomitant increase in antioxidant enzymes like CAT. Most importantly the IAA content was observed to be higher in non-ambient conditions (15°C, 35°C, and 45°C). Production of IAA at non-ambient temperature indicates that abiotic stress like temperature variations induces phytohormone production in cyanobacterial strains as a defense strategy to protect itself against changing environmental conditions.


Keyword:     Phytohormones Indole-3-acetic acid Temperature Stress Tryptophan


Citation:

Behera P, Kumar D, Mahalik S. Assessing the role of temperature as an elicitor for indole-3-acetic acid production in cyanobacterial species. J App Biol Biotech. 2024;12(2):204-211. http://doi.org/10.7324/JABB.2024.160443

Copyright: Author(s). This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike license.

HTML Full Text

ARTICLE HIGHLIGHTS

Environmental stress induces phytohormones synthesis in soil microorganisms. The present work is an experimental evidence of the temperature-induced synthesis of phytohormones Indole-3-acetic acid (IAA) in filamentous and single-celled cyanobacteria. Effect of ambient (25°C) and non-ambient temperatures (15°C, 35°C, and 45°C) on IAA production was studied. The results indicate that at non-ambient temperatures, the amount of stress generated are directly proportional to amount of IAA produced.


1. INTRODUCTION

The cyanobacteria are the microorganisms that are best suited to a variety of harsh environments. The earliest known photosynthetic species are cyanobacteria, which initially appeared 3.5 billion years ago. In addition to terrestrial, freshwater, and marine ecosystems, ice shelves, bare rocks, hot springs, and arctic and antarctic lakes, cyanobacteria can be found in a variety of situations [1]. Temperature stress is one evident stress brought on by seasonal and daily variations in climate [2]. Climate change and global warming increase the importance of temperature as one of the major stress factors that could be examined to understand the survival strategy of various extremophiles [3,4]. Based on their tolerance to temperature, cyanobacteria are classified into thermophilic, mesophilic, and psychrophilic. Hence, cyanobacteria are utilized as model organisms for determining defense strategies against stresses [5]. Defense strategies depend on how the species react to and adapt to heat stress. Cyanobacteria encounter both short- and long-term stress episodes, and they can adapt to the stress by changing their morphology, metabolism, and genetic makeup [6,7].

Many agricultural soils are home to cyanobacteria, which help with biological nitrogen fixation, phosphate solubilization, and mineral release to increase soil fertility and crop yield [8-10]. However, many cyanobacteria are also known to release a variety of biologically active substances, such as proteins, vitamins, carbohydrates, amino acids, polysaccharides, and phytohormones, which act as elicitor molecules to promote plant growth and aid them in the defense against biotic and abiotic stress [11,12]. This is in addition to naturally fertilizing and balancing the mineral nutrition in the soil. Auxins, gibberellins, cytokinins, and ethylene, which are involved in plants’ growth and development, are known to be significantly accumulated and released by various genera of cyanobacteria and algae [13-15]. Indole-3-acetic acid (IAA), a well-known auxin promotes plant development by controlling root elongation, tropic response, cell division, elongation, and differentiation [16]. IAA production has been demonstrated in a variety of cyanobacteria [17-19]. IAA-containing cyanobacterial extracts cause rooting and shooting in explants [20]. It has been noted that cyanobacteria can produce IAA by both tryptophan-dependent and tryptophan-independent pathways [21]. The following three IAA production pathways used by microbes are: Indole-3-acetamide (IAM) pathway, indole-3-acetonitrile (IAN) pathway, and indole-3-pyruvic acid (IPA) pathway. Bacteria use the IAM and IPA pathways more frequently than the IAN pathway, and they are all tryptophan-dependent [22]. L-tryptophan, a precursor to IAA, is needed by a number of cyanobacterial strains to produce the phytohormone. Cyanobacteria are a significant part of the flora in agricultural fields, thus it is crucial to understand how they contribute to the generation of IAA under temperature stress. In addition, stress alters physiological, biochemical, and morphological responses and negatively impacts cell growth and development [23].

We therefore set out to screen IAA-producing cyanobacterial strains and examine how temperature affects growth (as measured by cell density and chlorophyll A content), biochemical parameters (as measured by carbohydrate, protein, lipids, and extracellular polysaccharide), and stress markers such as malondialdehyde (MDA), Catalase (CAT), and ROS. As a result, their prospective use as a biostimulant would be established by the measurement of IAA produced by these cyanobacterial species under temperature stress.


2. MATERIALS AND METHODS

2.1. Sample Collection, Isolation, and Purification

Cyanobacterial samples were isolated from soil crust of coastal regions of Balasore district, Odisha. Crusts were inoculated on petri plates with BG-11 agar media and incubated under fluorescent light of 7.5 W/m2 intensity. After 7 days of incubation, some cyanobacterial colonies were seen growing in the media plate. These cyanobacterial colonies were purified by repeated culturing and transfer to a new media plate. A total of seven cyanobacterial strains were isolated following this method. Subsequently, the purified strains were transferred to Erlenmeyer flasks containing 25 mL of the same medium under the same conditions for maintenance. Axenic cyanobacterial cultures were obtained by treatment with an antibiotic mixture of 200 μg/mL ampicillin and 100 μg/mL streptomycin.

2.2. Detection of IAA

Salkowski colorimetric method was used to screen IAA-producing cyanobacteria [24]. 100mg of pure cultures of cyanobacterial isolates were inoculated into BG-11 medium and incubated at RT for 14 days. The cultures were kept in an aseptic environment and supplemented with various concentrations of filter sterilized tryptophan (0.1, 0.25, 0.5, 1, 2.5, and 5mg/ml) followed by incubation under 12:12 h light: Dark cycle conditions. After 14 days of incubation, the cultures were centrifuged at 10,000 RPM for 10 min and the supernatant was collected for IAA assay. The supernatant was then exposed to Salkowski’s colorimetric assay and the absorbance was measured at 535 nm.

2.3. Ultraviolet-Visible (UV-Vis) Spectrum of IAA Produced by Cyanobacteria

The spectral analysis of cell-free supernatant was done at variable wavelength using a UV-Vis spectrophotometer. The spectrum was run from 190 nm to 600 nm using appropriately diluted sample and compared with the standard IAA (11 μg/ml and 33 μg/ml).

2.4. Polyphasic Identification of Cyanobacterial Strains

Three cyanobacterial isolates that showed maximum IAA production were identified based on morphology following Komárek [25] and further confirmed by 16S rRNA gene sequencing. For phylogenetic analysis, total DNA was isolated using phenol-chloroform method. A part of the 16S rRNA gene was amplified using cyanobacterial universal primer 106F (5’CGGACGGGTGAGTAACGCGTGA3’) and 1387R (5’TAACGACTTCGGGCGTGACC3’). 20 μL reaction mixture was prepared which comprises 10 μL of SRL Taq Mix polymerase chain reaction (PCR) 2X Master Mix, 2.5 μL of the template DNA, 1 μL each of 10 mM of forward and reverse primers, and 5.5 μL of sterile water. The PCR thermal cycle comprised an initial denaturation step at 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, 55°C for 1 min 30 s, 72°C for 1 min 30 s, and the final extension at 72°C for 15 min. The 1281 bp amplified product was purified using Qiagen Gel purification kit. The gel-purified PCR products were submitted to Eurofins Genomics India Pvt. Ltd, Bengaluru, India, for sequencing. Sequences of 16S rRNA gene were compared with NCBI sequence database [GenBank] through BLAST (www.ncbi.nlm.nih.gov/BLAST).

2.5. Exposure of Cyanobacterial Strains to Temperature Stress

A seed culture was set up with 5 ml BG11 broth to which three axenic cyanobacterial cultures were inoculated and incubated for 3 days under fluorescent light of 7.5 W/m2 intensity at 25 ± 2°C under 12:12 h light: Dark cycle conditions. Once the cells are in log phase, they are sub cultured into four 50 ml BG 11 broth and again incubated for 5 days same conditions till the cells are in log phase. After 5 days, the four flasks were shifted to 15°C, 25°C, 35°C, and 45°C, respectively, and incubated under fluorescent light of 7.5 W/m2 for 12:12 h light: Dark cycle conditions. After 15 days, samples were harvested for biochemical analysis and estimation of growth.

2.6. Estimation of Growth

To estimate the total biomass, 1 ml culture was taken and homogenized. The optical density of the homogenized cultures was measured at 720 nm following which the samples were dried and the dry weight was estimated. In the case of cyanobacteria, total chlorophyll content is an indirect measurement of growth. For this, 1 ml culture is centrifuged at 10,000 rpm. To the pellet, 4 ml methanol is added and vortexed thoroughly. The mixture is incubated at 60°C water bath for 1 h. After incubation, the tubes are cooled and centrifuged at 10,000 rpm and the clear supernatant is taken for measuring OD at 665 nm.

2.7. Estimation of Macromolecular Content

The total carbohydrate content was estimated using Anthrone method [26]. Total protein content was estimated using Lowry method [27]. The total lipid was estimated using Vanillin-Phosphoric acid reagent [28]. Exopolysaccharide (EPS) estimation was done by using Anthrone reagent [29]. MDA content was estimated by protocol proposed by Heath and Packer, 1968 [30], CAT assay was done as per the protocol in the cited literature [31], and ROS estimation was done by protocol proposed by Able et al. [32].


3. RESULTS AND DISCUSSION

3.1. Screening of IAA Producing Strains

Seven cyanobacterial isolates were purified and named as FMU-PC1 to FMU-PC7. These isolates were tested for their ability to produce IAA using varying amounts (0.1, 0.25, 0.5, 1, 2.5, and 5 mg/ml) of tryptophan as a precursor. Production of IAA was concentration-dependent and increased with increasing concentration of L-tryptophan in the medium [Figure 1a]. This suggests that the tryptophan-dependent route for IAA synthesis is present in all strains. Spectral analysis using UV-visible spectrometry was done as a qualitative check for the sample purity and identity. The maximum absorption wavelength (λmax) of IAA obtained from the cell-free supernatant of cyanobacterial samples was compared with the λmax of standard IAA. The λmax of purified IAA was obtained in the range of 290–294 nm whereas that of standard IAA was obtained at 290 nm which confirmed the purity and quality of IAA produced by selected cyanobacterial species [Figure 1b].

Figure 1: (a) Tryptophan concentration dependent indole-3-acetic acid production by seven cyanobacterial pure cultures obtained from coastal regions of Balasore district of Odisha, India and (b) ultraviolet-visible spectral analysis of indole-3-acetic acid of cyanobacterial samples.



[Click here to view]

Out of seven strains, FMU-PC5 produced the highest concentration of IAA and the lowest level was observed in FMU-PC7. Since under stress conditions, different strains behave differently by altering their growth, metabolism, and physiology, we therefore selected three strains one unicellular (FMU-PC2) and two filamentous (FMU-PC1 and FMU-PC5) cyanobacteria for further study.

3.2. Molecular Analysis of the IAA-Producing Strains

Molecular characterization by 16S rRNA confirmed that FMU-PC1 pure cultures showed 100% similarity to Westiellopsis sp. TPR-29 (GenBank: MT350511.1), FMU-PC5 showed 100% similarity to Hapalosiphon sp. Ryu2-7DN_D3 (GenBank: LC325255.1), and FMU-PC2 showed 100% similarity to Chlorogloeopsis fritschii PCC 6912 (GenBank: MK953013.1).

3.3. Effect of Temperature on Growth

According to estimates, global warming may cause an increase of 0.2°C every 10 years [33]. Climate change-related abiotic stress induces cyanobacteria, which are known for their remarkable adaptability to many environmental situations, to change their metabolic function [5]. Temperature variation influences a wide range of biological processes, including the physiology and metabolism of cyanobacteria. The maximum biomass formation was observed at 25°C since this is the optimal temperature for cyanobacterial growth. As an indirect indicator of growth, chlorophyll A concentration is likewise reported to be maximum at 25°C. Both biomass (dry cell weight) [Figure 2a] and chlorophyll A concentration [Figure 2b] gradually decreased when temperature rose to 35°C and 45°C. The presence of chlorophyll A shows that the cells were still alive even though the dry cell weight had decreased. It is interesting that exposure to low temperatures, that is, 15°C, had little impact on growth. Cyanobacteria are widely known for their ability to live at extremely low temperatures, even down to 20°C [34]. This may be because desaturation of fatty acids in the membrane happens at low temperatures and activates certain enzymes that increase the efficiency of transcription and translation, enabling growth and metabolism at below-ambient temperatures [5]. This trend was obtained for all three strains Westiellopsis sp. TPR-29, Hapalosiphon sp. Ryu2-7DN_D3 and C. fritschii PCC 6912. Hapalosiphon sp. Ryu2-7DN_D3 and Westiellopsis sp. TPR-29 were more resistant to higher temperature, whereas C. fritschii PCC 6912 showed better growth at 15°C.

Figure 2: (a) Dry weight of cyanobacterial samples and (b) chlorophyll A content of cyanobacterial samples under different temperature.



[Click here to view]

3.4. Effect of Temperature on Carbohydrate Content

It was observed that 25°C was the ideal temperature for promoting growth and carbohydrate buildup because, at this temperature, cells’ capacity to use carbon and nitrogen rises dramatically. Higher temperature influences cellular physiology and results in denaturation of vital metabolites (enzymes/proteins), which lowers CO2 fixation, while lower temperatures during growth result in reduced electron transport [35]. As a result, the carbohydrate content was lower at 15°C and 35°C than it should have been. While at 45°C, there was a drastic fall in carbohydrate content, indicating that higher temperatures impair an organism’s ability to photosynthesize [Figure 3a]. All strains showed this tendency, with the exception of C. fritschii PCC 6912, whose carbohydrate content was nearly the same at 15°C and 25°C, showing that this species has a wide range of tolerance for low temperatures and can live and photosynthesize even at lower temperatures.

Figure 3: (a) Total carbohydrate content; (b) total protein content; (c) total lipid content; and (d) EPS content of cyanobacterial samples under different temperature.



[Click here to view]

3.5. Effect of Temperature on Protein Content

Under high-temperature stress, proteins frequently aggregate and desaturate, disrupting their transport and activities [5]. This is one of the main causes of the low protein content at 35°C and 45°C. All of the three strains showed this pattern [Figure 3b]. However, compared to the ambient temperature of 25°C, the protein concentration was considerably lower at 15°C. Low protein content may be a result of the cellular metabolism slowing down at non-ambient temperatures like 15°C, which also affects growth rate and total cell biomass, as seen in our study.

3.6. Effect of Temperature on Lipid Content

The generation of fatty acids by cyanobacteria can be drastically impacted by temperature. The lipid content of the cell often changes in response to stresses including temperature, salt, desiccation, and photoinhibition [36]. In the present study, it was observed that elevated temperature led to increase in lipid content [Figure 3c]. Maximal lipid concentration was found at 35°C, while maximal biomass formation is seen at 25°C. All of the strains’ total lipid contents increased along with the temperature as it went from 15°C to 35°C. Increased lipid production in response to temperature is likely caused by the requirement to stabilize membranes to sustain vital physiological functions. However, it was fascinating to note that very little lipid accumulation occurred at 45°C.

3.7. Effect of Temperature on Exopolysaccharide Content

EPSs provide a milieu that is structurally stable and well-hydrated for colonization of cyanobacteria. In addition, it offers chemical and physical defense against biotic and abiotic stressors. It is believed that EPS excretion serves as a physiological reaction to changes in the environment, enabling cyanobacteria to keep up their fitness while simultaneously supporting the expansion of other cohabiting organisms [37]. In this study, it was observed that the generation of EPS increased when the temperature rose from 15°C to 35°C. At 35°C, the highest EPS production was observed [Figure 3d]. According to earlier research, filamentous cyanobacteria produce their most EPS between 27°C and 34°C. Higher levels of EPS are produced and deposited at higher temperatures as a response to anticipated desiccation because desiccation is typically associated with greater temperatures [29].

3.8. Effect of Temperature on Stress Markers

Cyanobacterial physiology and metabolic behavior are predominantly impacted by abiotic stressors. As a result, a number of stimuli and other defense mechanisms are known to be induced in response to stress. One of them is reactive oxygen species (ROS) which are produced in response to various metabolic stress conditions. ROS can be reduced by a variety of enzymes, including superoxide dismutases (SOD), CAT, and guaiacol peroxidase, as well as non-enzymatic compounds such as carotenoids and glutathione reductase [38]. However, excessive free radical production can cause oxidative stress, which can harm cellular nucleic acids and structural integrity [39]. However, with an effective defense and repair system, cyanobacteria may recover from oxidative damages. This study looked at how different temperatures affected the levels of ROS [Figure 4a], CAT [Figure 4b] and MDA [Figure 4c]. In all of the non-ambient temperature conditions, as was to be predicted, the levels of all three stress markers were high, with the greatest levels being seen at 45°C [Figure 4a-c]. Antioxidant marker production suggests that non-optimal temperature causes a general stress response by generating ROS.

Figure 4: (a) Reactive oxygen species content; (b) catalase activity; and (c) malondialdehyde content of cyanobacterial samples under different temperature.



[Click here to view]

3.9. Effect of Temperature on IAA Production

IAA is a natural auxin that is synthesized in many species of non-seedling plants, bacteria, fungi, and algae [40]. A number of cyanobacteria have been reported to produce IAA. Several works have reported the effect of pH, salinity, incubation time, and concentration of Tryptophan on IAA production [41,42], but there are almost no records of effect of temperature on IAA synthesis by cyanobacteria. Effect of temperature on IAA production by various bacteria [43] and yeast [44] has been well established; hence, this study explored the role of temperature as an inducer of IAA production by cyanobacteria. It was observed that in all three strains IAA production was comparatively higher in non-ambient temperatures like (15°C, 35°C, and 45°C) than 25°C which is the optimum temperature for cyanobacterial growth. It was expected that at higher temperatures IAA production might be high, but in the case of Hapalosiphon sp. Ryu2-7DN_D3 and Westiellopsis sp. TPR-29, elevated amounts of IAA production were observed even at 15°C. Only C. fritschii PCC 6912 showed higher IAA titers at higher temperature. At 15°C, the IAA production by C. fritschii PCC 6912 was much less than the amount produced at optimum temperature. Overall highest titers of IAA were observed in Hapalosiphon sp. Ryu2-7DN_D3 followed by Westiellopsis sp. TPR-29 and C. fritschii PCC 6912 under various temperatures [Figure 5].

Figure 5: Indole-3-acetic acid produced by cyanobacterial samples under different temperature.



[Click here to view]

A two-way ANOVA was performed to analyze the effect of temperature on IAA production across different cyanobacterial strain. The amount of IAA produced by different strains at different temperature was statistically significant with a P-value of 2.51851e-14 (P < 0.05). Difference in IAA production by three cyanobacterial strains was also statistically significant with a P-value of 7.01295e-11 (P < 0.05). Similarly, statistically significant variation was observed in IAA production at various temperatures (P-value of 4.77249743587743e-17). The detailed two-way ANOVA analysis is presented in Table 1. This experiment indicates that any fluctuation in environmental temperature induces the cyanobacterial species to synthesize phytohormones like IAA as a defense mechanism to protect itself from metabolic stress.

Table 1: Two-way ANOVA analysis on effect of temperature on IAA production in various cyanobacterial species.

Source of variationSSdfMSFP-valueF crit
Cyanobacterial strains32440892162204547.976487.01E-113.259446
Temperature94727443315758193.394254.77E-172.866266
Interaction79223176132038639.05412.52E-142.363751
Within12171303633809.16
Total2185628147

ANOVA: Analysis of variance, IAA: Indole-3-acetic acid

Previously, it has been reported that among many compounds that cyanobacteria produce, IAA promotes growth and prevents organisms from environmental stress such as desiccation, osmotic, cold shock, and heat shock. Further, IAA activates the antioxidant activity in the cell by inducing the expression of antioxidant enzymes such as CAT, SOD, and peroxidase [45]. A similar results have also been obtained in the present study which corroborates with the cited literature.


4. CONCLUSION

The present study showed that temperature stress acts as an elicitor for IAA production by cyanobacterial strains. On the basis of habitat and tolerance of cyanobacteria toward temperature, they are classified as thermophilic, mesophilic, and psychrophilic; hence, these temperature ranges (15°C, 25°C, 35°C, and 45°C) were selected for the study [46]. As expected at optimum temperature of 25°C, the biomass and chlorophyll content as well as macromolecular content was highest for all selected species. Whereas at non-ambient temperatures, there was a concomitant decline in all growth and biochemical parameters, indicating the effect of temperature stress on physiology of the strains. As the strains were exposed to higher temperature, it resulted in reduction of growth and macromolecular contents whereas ROS and MDA content increased significantly at 45°C with a concomitant increase in antioxidant enzymes like CAT. Increase of ROS, MDA, and CAT levels at non-ambient conditions clearly emphasizes that fluctuations in incubation temperature elicit stress response in cyanobacteria. While these observations were similar across the selected temperature ranges for all three strains, but in terms of tolerance, Hapalosiphon sp. Ryu2-7DN_D3 was most tolerant to variations in temperature. The higher tolerance of Hapalosiphon sp. Ryu2-7DN_D3 is evident from the fact that it had higher growth as well as biomolecular content as compared to other strains during temperature stress. Whereas the unicellular cyanobacteria, C. fritschii PCC 6912 was most sensitive to temperature change. Most importantly, the IAA content was observed to be higher in non-ambient conditions (15°C, 35°C, 45°C). Hapalosiphon sp. Ryu2-7DN_D3 and Westiellopsis sp. TPR-29 produced almost similar levels of IAA at 15°C, 35°C, and 45°C. However, C. fritschii PCC 6912 produced IAA only at 25°C, 35°C, 45°C and the levels decreased at 15°C. Production of IAA at non-ambient temperature indicates that abiotic stress induces phytohormone production in cyanobacterial strains as a defense strategy to protect itself against changing environmental conditions.

Apart from protecting itself, cyanobacteria coexist with plants and mutually benefit each other. They not only fix nitrogen but also synthesize phytohormones like IAA that helps them in root colonization and parallelly improves plant vigor [47]. IAA isolated from yeast has been known to inhibit the growth of weeds and therefore can be used as a herbicide and replace the chemical herbicides [48]. Similarly, it has been observed that usage of IAA or cyanobacterial biofertilizer ameliorates the atrazine toxicity in paddy crops [45]. Role of cyanobacteria as biofertilizers and soil stabilizers in agriculture has been well proved where it promotes cell division and plant elongation [49]. Even they are known to protect plants from pathogenic infections [50]. Cyanobacteria has been known to increase saline tolerance in rice, where strains isolated from saline soils have led to increase in root length and promoted seedling growth and yield [51]. Gibberellic acid produced by cyanobacteria has also led to increase in shoot dry weight and carotenoid content in case of saline-stressed rice [52]. A significant contribution of cyanobacteria is the restoration of drylands in case of severe drought situations. Priming the soil with cyanobacterial strains increases water retention capacity of soils and thereby increases germination and seedling growth [53]. These characteristics of cyanobacteria are an advantage for increasing agricultural productivity. Like salinity and drought, temperature fluctuation is also an abiotic stress that inhibits plant growth, resulting in low agricultural yields. Hence, we propose that when soil temperature becomes unsuitable for plant growth, using cyanobacterial extracts as bio-stimulants may induce plant growth promotion by synthesizing various phytohormones.


5. ACKNOWLEDGMENTS

The authors acknowledge P.G. Department of Biosciences and Biotechnology, Fakir Mohan University, Balasore, for providing the research facilities. The authors sincerely appreciate the kind cooperation of P.G. Department of Environmental Science, Fakir Mohan University, Balasore, for their assistance. The Centre of Excellence for Bioresource Management and Energy Conservation Material Development, Fakir Mohan University is acknowledged for providing fellowship to Dhanesh Kumar.


6. AUTHOR’S CONTRIBUTIONS

Conceptualization: Shubhashree Mahalik and Dhanesh Kumar; Data acquisition/analysis: Priyanka Behera and Dhanesh Kumar; Data analysis/interpretation/drafting manuscript: Shubhashree Mahalik; Critical Revision of the manuscript: Shubhashree Mahalik and Dhanesh Kumar; and Supervision and final approval: Shubhashree Mahalik.


7. FUNDING

The work is funded by Centre of Excellence for Bioresource Management and Energy Conservation Material Development (Under Odisha Higher Education Program for Excellence and Equity (OHEPEE) Assisted by World Bank, Fakir Mohan University, Balasore-756089, Odisha, India.


8. CONFLICTS OF INTEREST

The authors report no financial or any other conflicts of interest in this work.


9. ETHICAL APPROVALS

All the data is available with the authors and shall be provided upon request.


10. DATA AVAILABILITY

All datasets were generated and analyzed in the present study.


11. PUBLISHER’S NOTE

This journal remains neutral with regard to jurisdictional claims in published institutional affiliation.

REFERENCES

1.  Sukenik A, Zohary T, Padisák J. Cyanoprokaryota and other prokaryotic algae. In:Encyclopedia of Inland Waters. Vol. 1. Netherlands:Elsevier Inc.;2009. 138-48. [https://doi.org/10.1016/B978-012370626-3.00133-2]

2.  Rezayian M, Niknam V, Ebrahimzadeh H. Stress response in Cyanobacteria. Iran J Plant Physiol 2019;9:2773-87.

3.  Panda AK, Mishra R, Miglani R, Dewali S, Kumar A, Bora S, et al. Extremophilic diversity and climate change. In:Biodiversity. United States:CRC Press;2023. 41-53. [https://doi.org/10.1201/9781003220398-4]

4.  Babu P, Chandel AK, Singh OV. Survival mechanisms of extremophiles. In:Extremophiles and their Applications in Medical Processes. 1st ed. Cham:Springer;2015. 9-23. [https://doi.org/10.1007/978-3-319-12808-5_2]

5.  Yadav P, Singh RP, Rana S, Joshi D, Kumar D, Bhardwaj N, et al. Mechanisms of stress tolerance in Cyanobacteria under extreme conditions. Stresses 2022;2:531-49. [https://doi.org/10.3390/stresses2040036]

6.  Dash SK, Pandey JK, Jena M, Biswal B. Effect of heat stress and the recovery potential of heterocystous Cyanobacterium, Anabaena iyengarii Bharadwaja 1935. J Pure Appl Microbiol 2020;14:2467-76. [https://doi.org/10.22207/JPAM.14.4.24]

7.  Rachedi R, Foglino M, Latifi A. Stress signaling in Cyanobacteria:A mechanistic overview. Life (Basel) 2020;10:312. [https://doi.org/10.3390/life10120312]

8.  Pathak J, Rajneesh MPK, Singh SP, Haeder DP, Sinha RP. Cyanobacterial farming for environment friendly sustainable agriculture practices:Innovations and perspectives. Front Environ Sci 2018;6:7. [https://doi.org/10.3389/fenvs.2018.00007]

9.  Chittora D, Meena M, Barupal T, Swapnil P, Sharma K. Cyanobacteria as a source of biofertilizers for sustainable agriculture. Biochem Biophys Rep 2020;22:100737. [https://doi.org/10.1016/j.bbrep.2020.100737]

10.  Ramakrishnan B, Raju MN, Venkateswarlu K, Megharaj M. Potential of microalgae and Cyanobacteria to improve soil health and agricultural productivity:A critical view. Environ Sci Adv 2023;2:586-611. [https://doi.org/10.1039/D2VA00158F]

11.  Singh S. A review on possible elicitor molecules of Cyanobacteria:Their role in improving plant growth and providing tolerance against biotic or abiotic stress. J Appl Microbiol 2014;117:1221-44. [https://doi.org/10.1111/jam.12612]

12.  Gonçalves AL. The use of microalgae and Cyanobacteria in the improvement of agricultural practices:A review on their biofertilising, biostimulating and biopesticide roles. Appl Sci 2021;11:871. [https://doi.org/10.3390/app11020871]

13.  Pichler G, Stöggl W, Carniel FC, Muggia L, Ametrano CG, Holzinger A, et al. Abundance and extracellular release of phytohormones in aero-terrestrial microalgae (Trebouxiophyceae, Chlorophyta) as a potential chemical signaling source1. J Phycol 2020;56:1295-307. [https://doi.org/10.1111/jpy.13032]

14.  Lu Y, Xu J. Phytohormones in microalgae:A new opportunity for microalgal biotechnology?Trends Plant Sci 2015;20:273-82. [https://doi.org/10.1016/j.tplants.2015.01.006]

15.  Liaimer A, Bergman B. Phytohormones in Cyanobacteria:Occurrence and perspectives. In:Biology of Plant-microbe Interactions. St Paul:International Society for Molecular Plant Microbe Interactions;2004. 394-7.

16.  Spaepen S, Vanderleyden J, Remans R. Indole-3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiol Rev 2007;31:425-48. [https://doi.org/10.1111/j.1574-6976.2007.00072.x]

17.  Jaiswal A, Das K, Koli DK, Pabbi S. Characterization of Cyanobacteria for IAA and siderophore production and their effect on rice seed germination. Int J Curr Microbiol Appl Sci 2018;7:212-22.

18.  Duong TT, Nguyen TT, Van Dinh TH, Hoang TQ, Vu TN, Doan TO, et al. Auxin production of the filamentous cyanobacterial Planktothricoides strain isolated from a polluted river in Vietnam. Chemosphere 2021;284:131242. [https://doi.org/10.1016/j.chemosphere.2021.131242]

19.  Ahmed M, Stal L, Hasnain S. Production of indole-3-acetic acid by the Cyanobacterium Arthrospira platensis strain MMG-9. J Microbiol Biotechnol 2010;20:1259-65. [https://doi.org/10.4014/jmb.1004.04033]

20.  Gayathri M, Kumar PS, Prabha AM, Muralitharan G. In vitro regeneration of Arachis hypogaea L. and Moringa oleifera lam. using extracellular phytohormones from Aphanothece sp. MBDU 515. Algal Res 2015;7:100-5. [https://doi.org/10.1016/j.algal.2014.12.009]

21.  Tan CY, Dodd IC, Chen JE, Phang SM, Chin CF, Yow YY, et al. Regulation of algal and cyanobacterial auxin production, physiology, and application in agriculture:An overview. J Appl Phycol 2021;33:2995-3023. [https://doi.org/10.1007/s10811-021-02475-3 https://doi.org/10.1007/s10811-021-02561-6]

22.  Patten CL, Glick BR. Bacterial biosynthesis of indole-3-acetic acid. Can J Microbiol 1996;42:207-20. [https://doi.org/10.1139/m96-032]

23.  Hasanuzzaman M, Nahar K, Alam MM, Roychowdhury R, Fujita M. Physiological, biochemical, and molecular mechanisms of heat stress tolerance in plants. Int J Mol Sci 2013;14:9643-84. [https://doi.org/10.3390/ijms14059643]

24.  Gang S, Sharma S, Saraf M, Buck M, Schumacher J. Analysis of indole-3-acetic acid (IAA) production in Klebsiella by LC-MS/MS and the Salkowski method. Bio Protoc 2019;9:e3230. [https://doi.org/10.21769/BioProtoc.3230]

25.  Komárek J. Süßwasserflora von mitteleuropa, Bd. 19/3:Cyanoprokaryota. In:3. Teil/3rd Part:Heterocytous Genera. Heidelberg:Spektrum Academischer Verlag;2013.

26.  Hedge JE, Hofreiter BT. Estimation of carbohydrate. In:Methods in Carbohydrate Chemistry. New York:Academic Press;1962. 17-22.

27.  Waterborg JH. The Lowry method for protein quantitation. In:The Protein Protocols Handbook. Totowa, NJ:Humana Press;2009. 7-10. [https://doi.org/10.1007/978-1-59745-198-7_2]

28.  Byreddy AR, Gupta A, Barrow CJ, Puri M. A quick colorimetric method for total lipid quantification in microalgae. J Microbiol Methods 2016;125:28-32. [https://doi.org/10.1016/j.mimet.2016.04.002]

29.  KvíderováJ, Kumar D, LukavskýJ, Kaštánek P, Adhikary SP. Estimation of growth and exopolysaccharide production by two soil Cyanobacteria, Scytonema tolypothrichoidesand Tolypothrix bouteillei as determined by cultivation in irradiance and temperature crossed gradients. Eng Life Sci 2019;19:184-95. [https://doi.org/10.1002/elsc.201800082]

30.  Heath RL, Packer L. Photoperoxidation in isolated chloroplasts:I. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys 1968;125:189-98. [https://doi.org/10.1016/0003-9861(68)90654-1]

31.  Aebi H. Catalase in vitro. Methods Enzymol 1984;105:121-6. [https://doi.org/10.1016/S0076-6879(84)05016-3]

32.  Able AJ, Guest DI, Sutherland MW. Use of a new tetrazolium-based assay to study the production of superoxide radicals by tobacco cell cultures challenged with avirulent zoospores of Phytophthora parasitica var nicotianae. Plant Physiol 1998;117:491-9. [https://doi.org/10.1104/pp.117.2.491]

33.  Hare B, Meinshausen M. How much warming are we committed to and how much can be avoided?Clim Change 2006;75:111-49. [https://doi.org/10.1007/s10584-005-9027-9]

34.  Ma J, Qin B, Paerl HW, Brookes JD, Hall NS, Shi K, et al. The persistence of cyanobacterial (Microcystis spp.) blooms throughout winter in Lake Taihu, China. Limnol Oceanogr 2016;61:711-22. [https://doi.org/10.1002/lno.10246]

35.  Juneja A, Ceballos RM, Murthy GS. Effects of environmental factors and nutrient availability on the biochemical composition of algae for biofuels production:A review. Energies 2013;6:4607-38. [https://doi.org/10.3390/en6094607]

36.  Singh SC, Sinha RP, Hader DP. Role of lipids and fatty acids in stress tolerance in Cyanobacteria. Acta Protozool 2002;41:297-308.

37.  Rossi F, De Philippis R. Role of cyanobacterial exopolysaccharides in phototrophic biofilms and in complex microbial mats. Life (Basel) 2015;5:1218-38. [https://doi.org/10.3390/life5021218]

38.  Rajput VD, Harish, Singh RK, Verma KK, Sharma L, Quiroz-Figueroa FR, et al. Recent developments in enzymatic antioxidant defence mechanism in plants with special reference to abiotic stress. Biology (Basel) 2021;10:267. [https://doi.org/10.3390/biology10040267]

39.  Fasnacht M, Polacek N. Oxidative stress in bacteria and the central dogma of molecular biology. Front Mol Biosci 2021;8:671037. [https://doi.org/10.3389/fmolb.2021.671037]

40.  Varalakshmi P, Malliga P. Evidence for production of Indole-3-acetic acid from a fresh water Cyanobacteria (Oscillatoria annae) on the growth of H. annus. Int J Sci Res Publ 2012;3:1-5.

41.  Prasanna R, Joshi M, Rana A, Nain L. Modulation of IAA production in Cyanobacteria by tryptophan and light. Pol J Microbiol 2010;59:99-105. [https://doi.org/10.33073/pjm-2010-015]

42.  Boopathi T, Balamurugan V, Gopinath S, Sundararaman M. Characterization of IAA production by the mangrove Cyanobacterium Phormidium sp. MI405019 and its influence on tobacco seed germination and organogenesis. J Plant Growth Regul 2013;32:758-66. [https://doi.org/10.1007/s00344-013-9342-8]

43.  Bessai SA, Bensidhoum L, Nabti EH. Optimization of IAA production by telluric bacteria isolated from Northern Algeria. Biocatal Agric Biotechnol 2022;41:102319. [https://doi.org/10.1016/j.bcab.2022.102319]

44.  Scarcella AS, Junior RB, Bastos RG, Magri MM. Temperature, pH and carbon source affect drastically indole acetic acid production of plant growth promoting yeasts. Braz J Chem Eng 2017;34:429-38. [https://doi.org/10.1590/0104-6632.20170342s20150541]

45.  Ahmad N, Yasin D, Bano F, Fatma T. Ameliorative effects of endogenous and exogenous indole-3-acetic acid on atrazine stressed paddy field cyanobacterial biofertilizer Cylindrospermum stagnale. Sci Rep 2022;12:11175. [https://doi.org/10.1038/s41598-022-15415-z]

46.  Chen CH, Berns DS. Thermotropic properties of thermophilic, mesophilic, and psychrophilic blue-green algae. Plant Physiol 1980;66:596-9. [https://doi.org/10.1104/pp.66.4.596]

47.  Hussain A, Hamayun M, Shah ST. Root colonization and phytostimulation by phytohormones producing entophytic Nostoc sp. AH-12. Curr Microbiol 2013;67:624-30. [https://doi.org/10.1007/s00284-013-0408-4]

48.  Bunsangiam S, Thongpae N, Limtong S, Srisuk N. Large scale production of indole-3-acetic acid and evaluation of the inhibitory effect of indole-3-acetic acid on weed growth. Sci Rep 2021;11:13094. [https://doi.org/10.1038/s41598-021-92305-w]

49.  Arafa AS, El-All AM. Evaluation of the technological properties of the bio-organic colored cotton. J Agron 2013;12:78-85. [https://doi.org/10.3923/ja.2013.78.85]

50.  Mazhar S, Hasnain S. Screening of native plant growth promoting Cyanobacteria and their impact on Triticum aestivum var. Uqab 2000 growth. Afr J Agric Res 2011;6:3988-93.

51.  El Sheek MM, Zayed MA, Elmossel FK. Effect of Cyanobacteria isolates on rice seeds germination in saline soil. Baghdad Sci J 2018;15:16-21. [https://doi.org/10.21123/bsj.15.1.16-21 https://doi.org/10.21123/bsj.2018.15.1.0016]

52.  Rodríguez AA, Stella AM, Storni MM, Zulpa G, Zaccaro MC. Effects of cyanobacterial extracellular products and gibberellic acid on salinity tolerance in Oryza sativa L. Saline Syst 2006;2:7. [https://doi.org/10.1186/1746-1448-2-7]

53.  Muñoz-Rojas M, Chilton A, Liyanage GS, Erickson TE, Merritt DJ, Neilan BA, et al. Effects of indigenous soil Cyanobacteria on seed germination and seedling growth of arid species used in restoration. Plant Soil 2018;429:91-100. [https://doi.org/10.1007/s11104-018-3607-8]

Reference

1. Sukenik A, Zohary T, Padisák J. Cyanoprokaryota and other prokaryotic algae. In: Encyclopedia of Inland Waters. Vol. 1. Netherlands: Elsevier Inc.; 2009. p. 138-48. https://doi.org/10.1016/B978-012370626-3.00133-2

2. Rezayian M, Niknam V, Ebrahimzadeh H. Stress response in Cyanobacteria. Iran J Plant Physiol 2019;9:2773-87.

3. Panda AK, Mishra R, Miglani R, Dewali S, Kumar A, Bora S, et al. Extremophilic diversity and climate change. In: Biodiversity. United States: CRC Press; 2023. p. 41-53. https://doi.org/10.1201/9781003220398-4

4. Babu P, Chandel AK, Singh OV. Survival mechanisms of extremophiles. In: Extremophiles and their Applications in Medical Processes. 1st ed. Cham: Springer; 2015. p. 9-23. https://doi.org/10.1007/978-3-319-12808-5_2

5. Yadav P, Singh RP, Rana S, Joshi D, Kumar D, Bhardwaj N, et al. Mechanisms of stress tolerance in Cyanobacteria under extreme conditions. Stresses 2022;2:531-49. https://doi.org/10.3390/stresses2040036

6. Dash SK, Pandey JK, Jena M, Biswal B. Effect of heat stress and the recovery potential of heterocystous Cyanobacterium, Anabaena iyengarii Bharadwaja 1935. J Pure Appl Microbiol 2020;14:2467-76. https://doi.org/10.22207/JPAM.14.4.24

7. Rachedi R, Foglino M, Latifi A. Stress signaling in Cyanobacteria: A mechanistic overview. Life (Basel) 2020;10:312. https://doi.org/10.3390/life10120312

8. Pathak J, Rajneesh MPK, Singh SP, Haeder DP, Sinha RP. Cyanobacterial farming for environment friendly sustainable agriculture practices: Innovations and perspectives. Front Environ Sci 2018;6:7. https://doi.org/10.3389/fenvs.2018.00007

9. Chittora D, Meena M, Barupal T, Swapnil P, Sharma K. Cyanobacteria as a source of biofertilizers for sustainable agriculture. Biochem Biophys Rep 2020;22:100737. https://doi.org/10.1016/j.bbrep.2020.100737

10. Ramakrishnan B, Raju MN, Venkateswarlu K, Megharaj M. Potential of microalgae and Cyanobacteria to improve soil health and agricultural productivity: A critical view. Environ Sci Adv 2023;2:586-611. https://doi.org/10.1039/D2VA00158F

11. Singh S. A review on possible elicitor molecules of Cyanobacteria: Their role in improving plant growth and providing tolerance against biotic or abiotic stress. J Appl Microbiol 2014;117:1221-44. https://doi.org/10.1111/jam.12612

12. Gonçalves AL. The use of microalgae and Cyanobacteria in the improvement of agricultural practices: A review on their biofertilising, biostimulating and biopesticide roles. Appl Sci 2021;11:871. https://doi.org/10.3390/app11020871

13. Pichler G, Stöggl W, Carniel FC, Muggia L, Ametrano CG, Holzinger A, et al. Abundance and extracellular release of phytohormones in aero-terrestrial microalgae (Trebouxiophyceae, Chlorophyta) as a potential chemical signaling source1. J Phycol 2020;56:1295-307. https://doi.org/10.1111/jpy.13032

14. Lu Y, Xu J. Phytohormones in microalgae: A new opportunity for microalgal biotechnology? Trends Plant Sci 2015;20:273-82. https://doi.org/10.1016/j.tplants.2015.01.006

15. Liaimer A, Bergman B. Phytohormones in Cyanobacteria: Occurrence and perspectives. In: Biology of Plant-microbe Interactions. St Paul: International Society for Molecular Plant Microbe Interactions; 2004. p. 394-7.

16. Spaepen S, Vanderleyden J, Remans R. Indole-3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiol Rev 2007;31:425-48. https://doi.org/10.1111/j.1574-6976.2007.00072.x

17. Jaiswal A, Das K, Koli DK, Pabbi S. Characterization of Cyanobacteria for IAA and siderophore production and their effect on rice seed germination. Int J Curr Microbiol Appl Sci 2018;7:212-22.

18. Duong TT, Nguyen TT, Van Dinh TH, Hoang TQ, Vu TN, Doan TO, et al. Auxin production of the filamentous cyanobacterial Planktothricoides strain isolated from a polluted river in Vietnam. Chemosphere 2021;284:131242. https://doi.org/10.1016/j.chemosphere.2021.131242

19. Ahmed M, Stal L, Hasnain S. Production of indole-3-acetic acid by the Cyanobacterium Arthrospira platensis strain MMG-9. J Microbiol Biotechnol 2010;20:1259-65. https://doi.org/10.4014/jmb.1004.04033

20. Gayathri M, Kumar PS, Prabha AM, Muralitharan G. In vitro regeneration of Arachis hypogaea L. and Moringa oleifera lam. using extracellular phytohormones from Aphanothece sp. MBDU 515. Algal Res 2015;7:100-5. https://doi.org/10.1016/j.algal.2014.12.009

21. Tan CY, Dodd IC, Chen JE, Phang SM, Chin CF, Yow YY, et al. Regulation of algal and cyanobacterial auxin production, physiology, and application in agriculture: An overview. J Appl Phycol 2021;33:2995-3023. https://doi.org/10.1007/s10811-021-02475-3

22. Patten CL, Glick BR. Bacterial biosynthesis of indole-3-acetic acid. Can J Microbiol 1996;42:207-20. https://doi.org/10.1139/m96-032

23. Hasanuzzaman M, Nahar K, Alam MM, Roychowdhury R, Fujita M. Physiological, biochemical, and molecular mechanisms of heat stress tolerance in plants. Int J Mol Sci 2013;14:9643-84. https://doi.org/10.3390/ijms14059643

24. Gang S, Sharma S, Saraf M, Buck M, Schumacher J. Analysis of indole-3-acetic acid (IAA) production in Klebsiella by LC-MS/MS and the Salkowski method. Bio Protoc 2019;9:e3230. https://doi.org/10.21769/BioProtoc.3230

25. Komárek J. Süßwasserflora von mitteleuropa, Bd. 19/3: Cyanoprokaryota. In: 3. Teil/3rd Part: Heterocytous Genera. Heidelberg: Spektrum Academischer Verlag; 2013. https://doi.org/10.1007/978-3-8274-2737-3

26. Hedge JE, Hofreiter BT. Estimation of carbohydrate. In: Methods in Carbohydrate Chemistry. New York: Academic Press; 1962. p. 17-22.

27. Waterborg JH. The Lowry method for protein quantitation. In: The Protein Protocols Handbook. Totowa, NJ: Humana Press; 2009. p. 7-10. https://doi.org/10.1007/978-1-59745-198-7_2

28. Byreddy AR, Gupta A, Barrow CJ, Puri M. A quick colorimetric method for total lipid quantification in microalgae. J Microbiol Methods 2016;125:28-32. https://doi.org/10.1016/j.mimet.2016.04.002

29. Kvíderová J, Kumar D, Lukavský J, Kaštánek P, Adhikary SP. Estimation of growth and exopolysaccharide production by two soil Cyanobacteria, Scytonema tolypothrichoides and Tolypothrix bouteillei as determined by cultivation in irradiance and temperature crossed gradients. Eng Life Sci 2019;19:184-95. https://doi.org/10.1002/elsc.201800082

30. Heath RL, Packer L. Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys 1968;125:189-98. https://doi.org/10.1016/0003-9861(68)90654-1

31. Aebi H. Catalase in vitro. Methods Enzymol 1984;105:121-6. https://doi.org/10.1016/S0076-6879(84)05016-3

32. Able AJ, Guest DI, Sutherland MW. Use of a new tetrazolium-based assay to study the production of superoxide radicals by tobacco cell cultures challenged with avirulent zoospores of Phytophthora parasitica var nicotianae. Plant Physiol 1998;117:491-9. https://doi.org/10.1104/pp.117.2.491

33. Hare B, Meinshausen M. How much warming are we committed to and how much can be avoided? Clim Change 2006;75:111-49. https://doi.org/10.1007/s10584-005-9027-9

34. Ma J, Qin B, Paerl HW, Brookes JD, Hall NS, Shi K, et al. The persistence of cyanobacterial (Microcystis spp.) blooms throughout winter in Lake Taihu, China. Limnol Oceanogr 2016;61:711-22. https://doi.org/10.1002/lno.10246

35. Juneja A, Ceballos RM, Murthy GS. Effects of environmental factors and nutrient availability on the biochemical composition of algae for biofuels production: A review. Energies 2013;6:4607-38. https://doi.org/10.3390/en6094607

36. Singh SC, Sinha RP, Hader DP. Role of lipids and fatty acids in stress tolerance in Cyanobacteria. Acta Protozool 2002;41:297-308.

37. Rossi F, De Philippis R. Role of cyanobacterial exopolysaccharides in phototrophic biofilms and in complex microbial mats. Life (Basel) 2015;5:1218-38. https://doi.org/10.3390/life5021218

38. Rajput VD, Harish, Singh RK, Verma KK, Sharma L, Quiroz-Figueroa FR, et al. Recent developments in enzymatic antioxidant defence mechanism in plants with special reference to abiotic stress. Biology (Basel) 2021;10:267. https://doi.org/10.3390/biology10040267

39. Fasnacht M, Polacek N. Oxidative stress in bacteria and the central dogma of molecular biology. Front Mol Biosci 2021;8:671037. https://doi.org/10.3389/fmolb.2021.671037

40. Varalakshmi P, Malliga P. Evidence for production of Indole-3-acetic acid from a fresh water Cyanobacteria (Oscillatoria annae) on the growth of H. annus. Int J Sci Res Publ 2012;3:1-5.

41. Prasanna R, Joshi M, Rana A, Nain L. Modulation of IAA production in Cyanobacteria by tryptophan and light. Pol J Microbiol 2010;59:99-105. https://doi.org/10.33073/pjm-2010-015

42. Boopathi T, Balamurugan V, Gopinath S, Sundararaman M. Characterization of IAA production by the mangrove Cyanobacterium Phormidium sp. MI405019 and its influence on tobacco seed germination and organogenesis. J Plant Growth Regul 2013;32:758-66. https://doi.org/10.1007/s00344-013-9342-8

43. Bessai SA, Bensidhoum L, Nabti EH. Optimization of IAA production by telluric bacteria isolated from Northern Algeria. Biocatal Agric Biotechnol 2022;41:102319. https://doi.org/10.1016/j.bcab.2022.102319

44. Scarcella AS, Junior RB, Bastos RG, Magri MM. Temperature, pH and carbon source affect drastically indole acetic acid production of plant growth promoting yeasts. Braz J Chem Eng 2017;34:429-38. https://doi.org/10.1590/0104-6632.20170342s20150541

45. Ahmad N, Yasin D, Bano F, Fatma T. Ameliorative effects of endogenous and exogenous indole-3-acetic acid on atrazine stressed paddy field cyanobacterial biofertilizer Cylindrospermum stagnale. Sci Rep 2022;12:11175. https://doi.org/10.1038/s41598-022-15415-z

46. Chen CH, Berns DS. Thermotropic properties of thermophilic, mesophilic, and psychrophilic blue-green algae. Plant Physiol 1980;66:596-9. https://doi.org/10.1104/pp.66.4.596

47. Hussain A, Hamayun M, Shah ST. Root colonization and phytostimulation by phytohormones producing entophytic Nostoc sp. AH-12. Curr Microbiol 2013;67:624-30. https://doi.org/10.1007/s00284-013-0408-4

48. Bunsangiam S, Thongpae N, Limtong S, Srisuk N. Large scale production of indole-3-acetic acid and evaluation of the inhibitory effect of indole-3-acetic acid on weed growth. Sci Rep 2021;11:13094. https://doi.org/10.1038/s41598-021-92305-w

49. Arafa AS, El-All AM. Evaluation of the technological properties of the bio-organic colored cotton. J Agron 2013;12:78-85. https://doi.org/10.3923/ja.2013.78.85

50. Mazhar S, Hasnain S. Screening of native plant growth promoting Cyanobacteria and their impact on Triticum aestivum var. Uqab 2000 growth. Afr J Agric Res 2011;6:3988-93.

51. El Sheek MM, Zayed MA, Elmossel FK. Effect of Cyanobacteria isolates on rice seeds germination in saline soil. Baghdad Sci J 2018;15:16-21. https://doi.org/10.21123/bsj.2018.15.1.0016

52. Rodríguez AA, Stella AM, Storni MM, Zulpa G, Zaccaro MC. Effects of cyanobacterial extracellular products and gibberellic acid on salinity tolerance in Oryza sativa L. Saline Syst 2006;2:7. https://doi.org/10.1186/1746-1448-2-7

53. Muñoz-Rojas M, Chilton A, Liyanage GS, Erickson TE, Merritt DJ, Neilan BA, et al. Effects of indigenous soil Cyanobacteria on seed germination and seedling growth of arid species used in restoration. Plant Soil 2018;429:91-100. https://doi.org/10.1007/s11104-018-3607-8

Article Metrics
469 Views 99 Downloads 568 Total

Year

Month

Related Search

By author names

Similar Articles

Characterization of indole-3-acetic acid in cambial zone tissue by ultra-performance liquid chromatography-tandem mass spectrometry

Renan Marcel Bonilha Dezena, Renata Mauri, Fabio Alessandro Proença Barros, Paulo César Pires Rosa

Plant growth-promoting potential of Diaporthe osmanthi COFS1, an endophyte of Coleus forskohlii

Riya Dutta, Debdulal Banerjee,

Amplification and cloning of mcrAgene from enriched consortia of Methanogens

Rachana Chandragupta Acharya, Usha Mukundan

Effect of drought stress on epicuticular wax load in peanut genotypes

Jayant K Solanki, S. K. Sarangi

Production and Optimization of Protease by Filamentous Fungus Isolated from Paddy Soil in Thiruvarur District Tamilnadu

Sudarkodi Chandrasekaran, Sundar Sundaram Pillai Kumaresan, Murugan Manavalan

Characterization of extracellular amylase from Bacillus sp. strain RU1

Aleem Basha Pinjari, Vijayalakshmi Kotari

The effects of diet and temperature on enzymes, hormones, and fecundity of the African Catfish Clarias gariepinus (Burchell 1822)

Waleed Abdul-Aziz A. Al-Deghayem, El Amin Mohamed Suliman

Partial purification and characterization of lectin from serum of American cockroach, Periplaneta americana

Reymend Encily Martin, Yogita Raosaheb Channe

Isolation and partial characterization of amylase produced by fungal isolates from the agro-industrial waste source

Soumya Nandi, Twinkle Bose, Susmita Mahato, Somashree Chatterjee, Annalakshmi Chatterjee

Cowpea (Vigna unguiculata L. Walp.): A choice crop for sustainability during the climate change periods

Tewodros Ayalew, Tarekegn Yoseph

Isolation and characterization of starch degrading bacteria from disparate soil samples

Vidhyutha Srivathsan, Mahima Bhandari, Priya Swaminathan

Screening and identification of heat tolerance in Indian wheat genotypes using generalized regression neural network (GRNN) model

Anil Kumar, Sadaf Fatima, Iffat Azim, Anshika Negi, Shalini Bhadola, Pooja Jha, Suboot Hairat

Effects of liquid storage of buck semen at refrigeration temperatures on sperm viability and fertility to develop ready to use goat semen diluent

Manish Kumar,, Ravi Ranjan, Alok Bhardwaj

Isolation and characterization of Soybean DREB 3 transcriptional activator

Sarosha Nasreen, J. Amudha, S. S. Pandey

Homology Modelling and Molecular Docking Study of Voltage Gated Ion Channels for their Role in Plant Abiotic Stress

Ravi Ranjan Kr. Niraj, Nikita Singh, Sween and Ajit Kumar

Asparagus racemosus extract increases the life span in Drosophila melanogaster

K. V. Kiran Kumar, K. S. Prasanna, J. S. Ashadevi

Insight into interplay of some molecular chaperones in a hill stream teleost, Barilius bendelisis under wide seasonal and diurnal thermal fluctuations

Saurabh Dewan,Yashpal Singh,JP Bhatt

Impact of Phyllanthus amarus extract on antioxidant enzymes in Drosophila melanogaster

N. Manasa, J. S. Ashadevi

Alterations in antioxidant defense system in hepatic and renal tissues of rats following aspartame intake

Saeed A. Alwaleedi

Dietary Supplementation of Citric acid (monohydrate) Improves Health Span in Drosophila melanogaster

Komal Panchala, Kesha Patelb , Anand K. Tiwaria

Physiological and biochemical characterization of Sesamum germplasms tolerant to NaCl

Tapaswini Hota, C. Pradhan, G. R. Rout

Biochemical Modulations in Duttaphrynus melanostictus Tadpoles, Following Exposure to Commercial Formulations of Cypermethrin: An Overlooked Impact of Extensive Cypermethrin use

David Muniswamy, Shrinivas S Jadhav, Kartheek R Malowade

DNP induced oxidative stress on blood components ameliorated by Pyrrole derivative of Tinospora cordifolia

K. C. Rashmi, H. S. Aparna

Effect of Artificially Induced Drought Stress on Seedlings of Pinus roxburghii Sarg

Ashish Tewari, Amit Mittal

Crosstalk of brassinosteroids with other phytohormones under various abiotic stresses

Farhan Ahmad, Ananya Singh, Aisha Kamal

Management of heat stress in Drosophila melanogaster with Abhrak bhasma and ascorbic acid as antioxidant supplements

Rambhadur P. Subedi, Rekha R. Vartak, Purushottam G. Kale

Assessment of biomarkers in acrylamide-induced neurotoxicity and brain histopathology in rat

Sreenivasulu Dasari, Muni Swamy Ganjayi, Sailaja Gonuguntla, Keerthi Ramineedu, Prabhakar Yellanur Konda, Balaji Meriga

A study on the salinity stress effects on the biochemical traits of seedlings and its relationship with resistance toward sensitive and tolerant flax genotypes

Yousef Alaei, Seyed Kamal Kazemitabar, Mohammad Zaefi Zadeh, Hamid Najafi Zarini, Gaffar Kiani

Antioxidant and antihyperlipidemic effects of aqueous seed extract of Daucus carota L. in triton ×100-induced hyperlipidemic mice

Habibu Tijjani, Abubakar Mohammed, Sani Muktar, Saminu Musa, Yusuf Abubakar, Adegbenro Peter Adegunloye, Ahmed Adebayo Ishola, Enoch Banbilbwa Joel, Carrol Domkat Luka, Adamu Jibril Alhassan

Role of glutathione reductase and catalase enzyme in antioxidant defense mechanism in controlling fluoride-induced oxidative stress

Komal Sharma, Mamta Choudhary, Khushbu Verma

Salt stress, its impacts on plants and the strategies plants are employing against it: A review

Zeenat Mushtaq, Shahla Faizan, Basit Gulzar

Biochemical and liver histological changes in rats exposed to sub-lethal dose of Uproot-pesticide and the protective potentials of nutritional supplements

Cosmas Onyekachi Ujowundu, Kingsley Isaac Ogamanya, Favour Ntite Ujowundu, Victoria Ojone Adejoh, Calistus I. Iheme, Kalu Okereke Igwe

Evaluation of Bacillus subtilis MRB4, as plant growth promoter and potential phosphate solubilizer under abiotic stress

Nishat Khatoon, Mazharuddin Khan

Linalool protects hippocampal CA1 neurons and improves functional outcomes following experimental ischemia/reperfusion in rats

Vishal Airao, Prakruti Buch, Tejas Sharma, Devendra Vaishnav, Sachin Parmar

Biochemical and ultrastructural alterations in the brain of mice induced by aqueous leaf extract of a medicinal plant, Lantana camara L. and its amelioration by nimodipine and flunarizine

H. Ashalata Singha, Mahuya Sengupta, Meenakshi Bawari

Biodiversity and bioprospecting of extremophilic microbiomes for agro-environmental sustainability

Ajar Nath Yadav

Chronic cold exposure aggravates oxidative stress in reproductive organs of STZ-induced diabetic rats: Protective role of Moringa oleifera

Hanumanthappa Rakesh, Saumya S. Mani, Piler Mahaboob Basha

Stress factors’ effects on the induction of lipid synthesis of microalgae

Shakirov Zair Saatovich, Khalilov Ilkhom Mamatkulovich, Khujamshukurov Nortoji

Correlates of sperm quality parameters and oxidative stress indices in diabetic rats exposed to cold stress: Role of Moringa oleifera leaf extract

Piler Mahaboob Basha, Hanumanthappa Rakesh, Saumya S. Mani

Leaf senescence and its regulation with phytohormones and essential elements: An overview

Shatrupa Singh, Madhulika Singh,, Sanskriti Bisht, Jai Gopal Sharma

Changes in the embryonic protein profile and hatching as a response to thermal stress in the Eri silkworm, Samia cynthia ricini

Punyavathi, Koushik Hullahalli Kumar, Sentimenla Moatemjen, Likhith Gowda Mahadevegowda, Manjunatha Hosaholalu Boregowda

Management of Meloidogyne incognita and salinity on sweet pepper (Capsicum annuum L.) with different arbuscular mycorrhizal fungus species

Idorenyin A. Udo, Aniefiok E. Uko, Ekemini E. Obok, Jesam O. Ubi, Sylvia B. A. Umoetok

Seed treatment with 24-epibrassinolide enhances soybean seed germination under salinity stress

Victoria Oko Otie, Idorenyin Udo, Shuoshuo Liang, Shao Yang, Michael Itam, Ping An, Egrinya Anthony Eneji

Effect of heavy metals on germination, biochemical, and L-DOPA content in Mucuna pruriens (L.) DC.

Akshatha Banadka, Praveen Nagella

Abiotic stress signaling in plants and transgenic technology as a triumph: A review

Seetha Babu Manepalli, Shraddha Tomar, Dinkar J. Gaikwad, Sagar Maitra

Implications of abiotic stress tolerance in arbuscular mycorrhiza colonized plants: Importance in plant growth and regulation

Madhulika Singh,, Sanskriti Bisht, Shatrupa Singh, Jai Gopal Sharma

Stress Adaptive Phosphorus Solubilizing Microbiomes for Agricultural Sustainability

Divjot Kour, Ajar Nath Yadav

Transaminases activity in the hemolymph: Biomarkers determining the thermal stress in the new bivoltine lines of Bombyx mori

J. Prashanth, H. B. Manjunatha

Evaluation of seven different wheat cultivars for their resistance to drought in terms of growth indicators and yield

Zeyad H. AL-Fatlawi, Ali Nadhim Farhood, Saleh Abed Alwahed Mahdi, Auday Hamid Taha Al-Tmime

Insights into the impact of spermidine in reducing salinity stress in Gerbera jamesonii

Javeria Uzma, Sai Krishna Talla, Praveen Mamidala

Isolation and characterization of bacteria possessing Osmotolerance activity from phylloplane of Centella asiatica

Sonal Gupta, Ashwini A. Waoo

Ascorbic acid and calcium chloride modulate protein profile and metabolites to adapt Indian almond seedlings to heat stress

Neven A. Abdullah, Haider S. Sh. AL-Jabir, Hussein J. Shareef

Assessment of oxidative stress, genotoxicity, and histopathological alterations in freshwater food fish Channa punctatus exposed to fungicide, Mancozeb

Manoj Kumar, Anjali Mishra, Akash Verma, Anamika Jain, Adeel Ahmad Khan, Shikha Dwivedi, Sunil P. Trivedi

Role of DREB genes in the regulation of salt stress-mediated defense responses in plants

Ashokkumar Ramakrishnan Yadav, Vaishnavi Ashokkumar, Suganthi Muthusamy, Senthilkumar Palanisamy

Plant growth regulator-mediated response under abiotic stress: A review

Shahreen Khan, Ravinder Singh, Harpreet Kaur, Ajay Kumar, Amit Vashishth, Moyad Shahwan,, Hardeep Singh Tuli

Performance of polymer-coated cotton seeds under various moisture stress conditions

V. Manonmani, S. Ambika, R. Paramasivam, K. Mohanraj, S. Laksmi, S. Kavitha, V. Vijaya Geetha, S. Deepika

Performance of mungbean (Vigna radiata L. Wilczek) accessions under intermittent water deficit stress in a tropical environment

Uchenna Noble Ukwu, Blessing Ngozika Oburu, Delight Promise Udochukwu,, Solomon Oluwaseyi Adewuyi, Stella Ogochukwu Muojiama, Vivian Ogechi Osadebe, Ifesinachi Nelson Ezeh, Patience Ukamaka Ishieze, Nathaniel Dauda

Plant growth-promoting rhizobacteria: Influence to abiotic stress tolerance in rice (Oryza sativa L.)

Trinayana Sonowal, Namrata Gupta, Sanjeev Kumar, Sarvesh Rustagi, Sangram Singh, Ashutosh Kumar Rai, Sheikh Shreaz, Rajeshwari Negi, Ajar Nath Yadav,

Role of zinc oxide nanoparticles in alleviating sodium chloride-induced salt stress in sweet basil (Ocimum basilicum L.)

Syed Aiman Hasan, Adnan Khan, Mohd Irfan

Behavior of new citrus hybrid rootstocks under water stress in greenhouse conditions

M’hamed Majji,, Ouiam Chetto, Abdelhak Talha, Ghizlane Bouaaza,, Rachid Benkirane, Hamid Benyahia

Boosting agronomic traits and enhancing water use efficiency in rice lines incorporated with qDTY3.1 and qDTY2.1

Vignesh Palani, Sunitha Selvaraj, Karthika Muthuswamy, Bharathkumar Srinivasan, Selvaraj Jagannathan, Maghimaa Mathanmohun

The protective action of a novel DinB protease against diarrhea infection in Drosophila Melanogaster

Jyoti Guleria, Mohammad Rashid Khan, Minhaj Ahmad Khan

The influence of light-emitting diodes and sulfur–silica on the growth, yield, and biochemical content in lettuce Influence of LEDs and sulfur–silica on lettuce

Slameto, Danil Eka Fahrudin, Dimvy Rusefani Asetya, Muhamad Wahyu Saputra, Nak-Young Baek, Cheol-Woo Shin, Dong-Kyu Lee, Woo-Won Kang

Consumption of corn and soybean sprouts enriched with egg shell in improving oxidative stress and estrogen depletion in ovariectomized rats

Siti Aminah, Wulandari Meikawati, Sri Hartati, Diode Yonata

Introgression of qDTY1.1 into genetic background of a modern rice variety (ADT36) and field performance under different environmental conditions

Salomi Rajendiran, Vignesh Palani, Bharathkumar Srinivasan

Melatonin: Possible mechanism of commercial production by cyanobacteria for human welfare and sustainable agriculture

Sakshi Pandey, Shobhit Raj Vimal, Sheo Mohan Prasad

Flood stress and its effects on fruit crops: A critical review

S. R. Jervin Ananth, Sajan Kurien, V. Suresh, P. Ramesh Kumar, K. Indira Petchiammal

Evaluation of chromium stress tolerance in endophytic bacteria isolated from chickpea root nodules and their plant growth-promoting traits

Sudipta Majhi, Mausumi Sikdar

Oxidative status of cryopreserved sperm of stallions of different ages

Anna Mikhailovna Shitikova, Mikhail Mikhailovich Atroshchenko, Valentina Ivanovna Zvyagina, Marya Alexandrovna Aronova

Boosting maize yield and root traits with salt-tolerant plant growth-promoting rhizobacteria in the Indo-Gangetic plain: A microbial solution to soil salinity

Alok Kumar Singh,, Adarsh Kumar,, Ashish Ranjan Udgata, Parul Tyagi, Mala Trivedi, Alok Kumar Srivastava

PGPR-Mediated Amelioration of Drought Stress Tolerance through Bacillus vallismortis MD-7 and Bacillus mycoides MD-18 in maize (Zea mays)

Alok Kumar Singh,, Parul Tyagi, Mala Trivedi, Alok Kumar Srivastava

Lycopene in crops: Biosynthesis, environmental regulation, bioavailability, health effects, and industrial applications

Steffanny Sánchez-Portillo, Laura Castro-Rosalez, Álvaro Pastrana-Pastrana, Lizeth Guadalupe Campos-Muzquiz, Sarahí del Carmen Rangel-Ortega, Fabián Pérez-Labrada

Endophytes and their significance in plant health and agricultural sustainability

Tarun, Kalpna Thakur, Smriti Mall, Megha Katoch, Sara Jahnawe, J. Joseph John Paul, Shreya Brohma, Manisha Sahoo, Sonika Kalia, Gurpreet Kaur

Early physiological and antioxidant responses of amla (Phyllanthus emblica L.) to short-term COexposure

Jangala Krishna Pallavi, Taarana Koganti, Murtaza Shehabi