Home > Past Issue

Volume: 1, Issue: 2, July- Aug, 2013
DOI: 10.7324/JABB.2013.1205

Research Article

Frequencies of Insulin- Promoter Factor-I (IPF-I) gene mutations in a Cohort of Sudanese Patients with Type 2 Diabetes Mellitus

Nahla A Elsheikh and Eltahir AG Khalil

Abstract

Diabetes mellitus (DM) refers to a group of metabolic disorders with defective insulin secretion, insulin action or both. Insulin promoter factor-1 (IPF-1) gene plays a central role in the development of the pancreas and regulation of insulin gene expression in β cells. This study aimed to determine the frequencies of C18R,D76N, and R197H mutations in the coding region of the IPF-1gene in a cohort of Sudanese patients with type 2 DM. Following informed consent, 96 individuals in eleven families with one or more diabetic members.DNA was extracted from EDTA-venous blood and buccal washes using the phenol-chloroform-iso-amyl alcohol (PCI) technique. Three variants (C18R, D76N, and R197H) were screened for by PCR-RFLP and the following primers:[F: CATGAACGGCGAGGAGCAG][R: GCCATGTACAGGCACGCAG][F: TCCCGTACGAGGTGCCCCCCCTCGCCGTC] [R: CGGTTGGGCTCCTCCAGGAC][F: GGTGGAGCTGGCTGTCATGTTG] [R: AGGGCTGTGGCGACGCGTAAG] primers and:[NlaIII, SalI and Fnu4HI] restriction enzymes for C18R, D76N and R197H mutations respectively.A third (31/96, 32.3%) of the study individuals were diabetics with a mean age of 53±14.2years compared to 28±17.1years in non-diabetics. More than 95% of the diabetics were in the first and second generations. C18R gene mutation was detected in 3.2% of the diabetics and in 4.9% of non-diabetics. The D76N was seen in 3.1% of non-diabetic subjects only. The R197H gene variant was not detected in the study population. There was a strong correlation between maternal history of DM and the incidence of diabetes in the study families. C18R and D76Ngenes mutations play little part in the development of DM type 2 in Sudanese patients. Maternal family history correlates strongly to the development of type 2 DM.

Keywords: Insulin-promoter Factor-1, gene mutations, type 2 DM, Sudan.

References

How to cite this article:

ARTICLE TOOLS

ARTICLE STATISTICS

  • Viewed: 679
  • Downloaded: 171

  Search by Author


      

  Search in Pubmed


   Search in Google Scholar